1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
5

cotton-topped tamarins are small primates with tufts of long white hair on their heads. While studying these creatures, you noti

ce that males with longer hair get more opportunities to mate and father more offspring. To test the hypothesis that having longer hair is adaptive in these males, you should________.
Biology
1 answer:
Margaret [11]3 years ago
7 0
<h2>Genetic code is (nearly) universal in evolution</h2><h3>Explanation:</h3>
  • It determine whether hair length is heritable, The genetic code is discretionary, at any rate of extent. The way that all life forms share a solitary genetic code is because of their basic ancestry. Development represents the solidarity and diversity of life  
  • This is because a genetic code shared by diverse life forms gives significant proof to the regular starting point of life on Earth. That is, the numerous species on Earth today likely developed from a tribal living being in which the genetic code was at that point present. Since the code is fundamental to the capacity of cells, it would will in general stay unaltered in species across ages, as people with critical changes may be not able to survive.
You might be interested in
Of the inner planets, the planet with the highest percentage of atmospheric oxygen is A) Earth B) Mars C) Mercury D) Venus
serious [3.7K]

Answer:

A) Earth

or C) Mercury

sorry i wasn't that much help but i narrowed it down.

5 0
3 years ago
Read 2 more answers
I need help with this pleas
Yakvenalex [24]

Answer:

To maintain homeostasis within the cell

Explanation:

The function of the cell membrane is to maintain homeostasis (stable environment) within the cell.

3 0
2 years ago
Read 2 more answers
The interdependence of body systems is essential because
QveST [7]
 c<span>: The interdependence of body systems is essential because all systems work together to maintain homeostasis.</span>
6 0
2 years ago
Help me pls!will give brainliest
Margarita [4]
The answer is A
Using energy
5 0
2 years ago
Describe three types of relationships between organisms found within an ecosystem. How is energy transferred in each type of rel
maks197457 [2]
Well, there's producers and consumers. There is also one provider that is the main source of energy for all living things which is the sun. The sun provides sunlight for the producers to make their own food through photosynthesis then consumers come and eat the producers(plants) and that gives them energy. And then predators come and eat that animal and that provides their energy.
4 0
3 years ago
Other questions:
  • Process by which two simple molecules are joined by the removal of one water molecule
    7·1 answer
  • Which aspect of the angiosperm life cycle and morphology, depicted above, is not unique to angiosperms?
    10·1 answer
  • _____ believed that classical conditioning occurred because the conditioned stimulus became a substitute for the unconditioned s
    8·1 answer
  • There are three essential components of all homeostatic control mechanisms; control center, receptor, and effector. The __(1)___
    8·1 answer
  • We have all seen the moon shining at night, whether it is a small sliver or a large full moon.
    11·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • EVEN MORE POINTS, again I luv all of you and hope you all have a great day.
    15·2 answers
  • According to the model, when was the universe at its most dense?
    7·1 answer
  • Which two parts of sedimentary rocks formation include the breakdown and carrying away of existing rock
    9·1 answer
  • In addition to the leaf shape (narrow and broad) and leaf vein arrangement (parallel and non-parallel), leaf ______ is used to c
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!