1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
4 years ago
11

Is this true? Living things can be studied at different levels of organization, from the molecule level to the largest level, th

e ecosystem.
Biology
1 answer:
Sloan [31]4 years ago
3 0
I think it is true that living things can be studied at different levels of organization. it probably just determines on what living things and what organization. sorry to confuse you a little but that would just be my opinion
You might be interested in
Staphylococcus and Streptococcus can be easily differentiated in a laboratory by which one of the following? A) Cell shape B) Gr
Zarrin [17]

(C): growth in high salt concentrations

3 0
4 years ago
In pea plants, seed shape is a trait controlled by a single gene. the round seed trait is dominant to the wrinkled seed trait. w
ipn [44]
If you can use any letters, it would have to be 2 lower case letters such as tt
8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What is a substrate?
Lady_Fox [76]
A substrate is a reactant that is catalyzed by an enzyme.
4 0
3 years ago
Read 2 more answers
What are the two techniques used to create a DNA profile in this experiment? What
Vedmedyk [2.9K]

RFLP, AmpFLP are the two techniques which is used to create DNA profile

Explanation:

<u>RFLP technique: </u> RFLP technique stands for “Restriction Fragment Length Polymorphism”. It is molecular method of genetic analysis which allows to identified based unique pattern of restriction enzyme where DNA is cutting in specific regions. It requires large amount of sample. The costing is very high  

<u>AmpFLP: </u>The AmpFLP stands for amplified length polymorphism. It is PCR based tool. Firstly, it uses as restricted enzyme. It is cheaper than RFLP technique. It is used as genetic engineering

3 0
3 years ago
Other questions:
  • An Electromagnet can be made by wrapping wire around witch object?
    12·2 answers
  • What are 4 effects of global warming
    9·1 answer
  • The discovery of ______ is used as support for the motor theory of speech perception.
    10·1 answer
  • During meiosis, a defect occurs in a cell that results in the failure of microtubules, spindle fibers, to bind at the kinetochor
    8·1 answer
  • Explain the difference between repetition and replication. plz
    8·2 answers
  • Which part of the microscope are objective lenses attached?​
    7·2 answers
  • During which phase do the chromosomes make copies of themselves so that there are two of each one?
    12·1 answer
  • I need help with dis too plz?
    7·2 answers
  • PLEASE HELP!!!!!<br> What happens to the original DNA strand after transcription?
    14·2 answers
  • form and function are related. describe how the form of the tracheal wall is related to its four functions
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!