1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
12

Considering that males can have Klinefelter (XXY) syndrome, XYY, and normal XY chromosomal combinations, and females can have Tu

rner (XO) syndrome, poly-X (XXX, XXXX), and normal XX combinations, it is obvious that:_________.
(A) maleness results from the presence of only one X chromosome
(B) maleness results from the absence of two or more X chromosomes
(C) maleness results from the minimal presence of one Y chromosome
(D) femaleness results from the presence of two or more X chromosomes
Biology
1 answer:
mestny [16]3 years ago
6 0

Answer:

C) maleness results from the minimal presence of one Y chromosome

Explanation:

  • From the given question, it can be clearly observed that in males irrespective of whichever syndrome they have a Y chromosome is always present whereas in females Y chromosome is not present.
  • Hence, one cal conclude that whenever the Y chromosome is present the individual acquires male characters.
  • The Y chromosome whenever present produces the hormones that leads to maleness, and the number of Y chromosomes in males can also be more than  one such as in case of XYY Klinefelter syndrome.

You might be interested in
Red:hydrogen, black:Carbon, purple:oxygen, green:nitrogen
boyakko [2]
The macromolecule would be glucose (sugar). C6H12O6
5 0
3 years ago
What is the function of a smooth muscle tissue? ​
spin [16.1K]

Answer:

Smooth muscle is found in the walls of hollow organs like your intestines and stomach. They work automatically without you being aware of them. Smooth muscles are involved in many 'housekeeping' functions of the body. The muscular walls of your intestines contract to push food through your body.

Explanation:

4 0
3 years ago
What could a human living now and a horse living thousands of years ago
Triss [41]
A. They are made of some of the same matter

ex: humans and horses are both mammals. We both of bones and grow up feeding from our mothers milk. We do not have the same dna, we are not autotrophs, and we need different amounts of energy to survive
7 0
3 years ago
What is the other name for the constellation seen here ?
swat32

Answer:

Another name of constellation is

group of star.

5 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Other questions:
  • Can someone please help me
    12·1 answer
  • Which component of the cardiovascular system allows the body to function by supplying the cells with oxygen?
    11·1 answer
  • Air pressure __________ as we rise higher in the Earth's atmosphere. increases decreases
    11·1 answer
  • The air component in soil provides plants with the what needed for photosynthesis
    13·1 answer
  • Which is not an example of matter and energy cycling through living things?
    7·2 answers
  • What is one major difference between federal and unitary governments?
    15·1 answer
  • Help! I need help with this ASAP, I'm so confused for this.
    9·1 answer
  • A Vaccine normally given to children against Tuberculosis​
    7·1 answer
  • Why is it so important for animals to keep the concentration of their body fluids constant​
    7·1 answer
  • What traditional christmas decoration is actually a parasitic plant?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!