1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
14

Describe the relationship between cells and organisms

Biology
1 answer:
Elden [556K]3 years ago
7 0
Cells are the basic unit of structure and function in organisms.
Needless to say, organisms can’t be a thing if cells didn’t exist.
You might be interested in
Mark is on a strict diet. He has cut down on fats in order to lose weight. Because Mark is severely restricting his fat intake,
timofeeve [1]
<span>Mark may be getting lower amounts of nutrients and vitamins, namely omega-3s and omega-6s. This would directly affect the brain and normal body functions because the body needs vitamins/nutrients to thrive. This could affect the chemical balance in his brain, resulting in depression/schizophrenia/other issues, including eating disorders. Cutting down on fats might also result in overeating carbs and protein, which leads to an overbalance of nutrients -- and a host of other health issues.Not getting enough fat could also affect bone growth.</span>
3 0
3 years ago
Where is the ozone found? Why is it important?
o-na [289]

Answer:

B

Explanation:

Stratosphere,absorbs rays of damaging ultraviolet light from the sun

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Salivary amylase is released in the mouth where it breaks down sugars. however, it is inactive once it reaches the stomach where
GREYUIT [131]
<span>Amylase needs an optimum pH for its activity. It is in the range of 6-7. Below or above pH will denature this enzyme. The pH level is optimum for this enzyme in the mouth and hence it catalyses the break down of sugar. The pH level of stomach is lower than its optimum level duet to the activity of gastric acid. Hence the enzyme becomes inactive in the stomach.</span>
5 0
3 years ago
How many grams are NaCl are required to prepare 200 mL of a 3.10 M solution?
rodikova [14]

The mass (in grams) of NaCl required to prepare the solution is 36.27 g

<h3>What is molarity?</h3>

Molarity is defined as the mole of solute per unit litre of solution. Mathematically, it can be expressed as:

Molarity = mole / Volume

<h3>How to determine the mole of NaCl</h3>
  • Volume = 200 mL = 200 / 1000 = 0.2 L
  • Molarity = 3.1 M
  • Mole of NaCl =?

The mole of NaCl in the solution can be obtained as follow:

Molarity = mole / Volume

Cross multiply

Mole = Molarity x Volume

Mole of NaCl = 3.1 × 0.2

Mole of NaCl = 0.62 mole

<h3>How to determine the mass of NaCl </h3>

We can obtain the mass of NaCl needed to prepare the solution as follow:

  • Molar mass of NaCl = 58.5 g/mol
  • Mole of NaCl = 0.62 mole
  • Mass of NaCl = ?

Mole = mass / molar mass

Cross multiply

Mass = mole × molar mass

Mass of NaCl = 0.62 × 58.5

Mass of NaCl = 36.27 g

Learn more about molarity:

brainly.com/question/15370276

#SPJ1

6 0
2 years ago
Other questions:
  • Human abo blood groups are determined by a single gene with 3 alleles: a, b, and o. in a sample of 300 individuals, 100 are bloo
    10·1 answer
  • What empirical evidence supports the theory of plate tectonics? Help fast plzzzzzzzzzzzzzzzz
    7·1 answer
  • Can someone help me please fast
    14·1 answer
  • Nilai suhu reamur ke fahrenheit
    9·1 answer
  • How many factors should a well-designed experiment test at one time?
    15·1 answer
  • Which indicators are living and non-living?
    15·1 answer
  • Can some one help???
    9·2 answers
  • During the S stage of interphase the DNA is copied. The result of this process is two copies of the DNA molecule with each copy
    10·2 answers
  • What is the difference between the theory of continental drift and the theory of plate tectonics?
    15·1 answer
  • What kind of genetic disorder is pictured in the pedigree?<br><br> A. Recessive <br> B. Dominant
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!