1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semmy [17]
3 years ago
5

1. Blood in the gills runs in the opposite direction as the water outside the gill filaments. By running in the direction opposi

te the flow of water, the blood is always exposed to an area of water that has a higher level of oxygen. Oxygen moves across the membranes by diffusion. So if the gill had more oxygen than the water, the fish would lose oxygen to its surroundings. This is an example of:
Biology
1 answer:
soldier1979 [14.2K]3 years ago
7 0

Answer:

Counter current  system  for oxygen exchange. This  process allow the exchange through diffusion of oxygen from higher concentration of water to lower concentration in the fish blood, from the surface of the  fish lammela,Therefore as  blood flows through the gill capillaries,oxygen at higher diffusion gradient,enters the capillaries, sustained by higher diffsuion rate of Oxygen Counter by opposite blood flow.

Explanation:

You might be interested in
An object from space burning up as it enters the atmosphere of a planet
Elina [12.6K]
Did you try asteroid?
7 0
2 years ago
Read 2 more answers
Suppose that life exists elsewhere in the universe. all life must contain some type of genetic information, but alien genomes mi
Snowcat [4.5K]
<span>While alien genomes may be constructed by completely different molecules (for example, silicon based life forms are a possibility rather than carbon) it is logical to assume that all life forms would have some sort of protective mechanism to prevent the degradation of DNA during replication. Essentially, to prevent mutations and rapid aging, DNA, alien or otherwise, would have some types of telomeres. They might either be long chains of repeated or irrelevant code or molecules that would not be easily corrupted.</span>
3 0
3 years ago
Based on the data in Table 1, identify the animal that has the greatest number of sequence differences from the reference animal
Doss [256]

Answer:

( please like and hope it helps)

A) Elephas-2 has 13 sequence differences from the reference animal, and this is the greatest number of animals in the table.

B) From left to right, the order at the tips of the cladogram is: Dugong , Elephas , Loxodonta , Mammathus.

(Loxodonta and Mammuthus can also be reversed)

C) The molecular data, such as that for are widely conserved protein such as cytochrome b , show conserved similarities between organisms such as to dugongs and proboscideans and can be used to support the existence of this relationship.

D) The animals that are related ones had a common assister with certain genetic characteristics. Adaptation to different habitats leads to diversification of morphology but does not change evolutionary relationships.

4 0
3 years ago
Which of the following processes does not involve transferring carbon from the living environment to the nonliving environment.
Varvara68 [4.7K]
Photosynthesis 
the equation is- Carbon dioxide + water = oxygen + glucose 
6 0
2 years ago
DNA is produced in the mitochondria. genetic material that directs the cell. responsible for directing the activities of the cel
Artist 52 [7]
No that is just, no just no. DNA is copied through cell reproduction where a cell splits to create more (growing for multi called organisms and asexual reproduction for single celled organisms) The mitochondria is an organelle that is the "power house" of the cell, the "digestive system".
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • To reduce the incidence of complications in a client in traction, which intervention should be included in the care plan? increa
    14·1 answer
  • The three major parts of the brain are the: Select one: a. midbrain, cerebellum, and spinal cord. b. cerebellum, medulla, and oc
    15·1 answer
  • How does water's temperature affect the amount of oxygen in it
    9·1 answer
  • Which is the first step that geologists must do to compare rock layers at distant locations? 1.find the absolute age of rocks at
    6·2 answers
  • Where does the energy to change the shoreline come from?
    11·1 answer
  • How did the bacteria S. aureus change over time?
    8·1 answer
  • I need help with the explanation and answer with the explanation it would be nice cause I would understand. So please help! Brai
    8·1 answer
  • Which of these resources CANNOT be produced sustainably?
    8·1 answer
  • A neuron with several extensions coming off of the soma is categorized as a neuron.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!