1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
3 years ago
15

Harry notices that one of his houseplants does not grow very well compared to his other houseplants. He asks himself “What is di

fferent with this plant that does not grow very well compared with the other house plants?” Harry then goes to his computer to use the internet to look up what other people have done when faced with this problem. Harry then hypothesizes that this houseplant is not getting as much sunlight as the other plants. Which of the following selections defines Harry’s problem?
A .When Harry notices that a houseplant is not growing well.

B .When Harry looks up possible explanations on the internet.

C .When Harry asks “What is different with this plant that does not grow very well compared with the other house plants?”

D .When Harry hypothesizes that the houseplant is not getting as much sunlight as the other plants.
Biology
1 answer:
Ugo [173]3 years ago
5 0
The correct answer is C. "when Henry ask "what is different with this plant that does not grow very well compared with the other house plants?" "
You might be interested in
Antibiotics can be used to treat
ozzi

Answer:

Antibiotics are strong medicines that treat bacterial infections.

8 0
3 years ago
Read 2 more answers
What are the components of adenosine triphosphate (ATP)?
Liula [17]

Answer:

base, sugar and three phosphates

3 0
3 years ago
Describe the difference between organic and inorganic carbon.
xeze [42]
The primary difference between organic vs. inorganic compounds is that organic compounds always contain carbon while most inorganic compounds do not contain carbon
4 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
How is the information contained in a signaling molecule received by a cell?
Natalija [7]

Answer: Depending on the nature of the signaling molecule, it may either bind to and activate a receptor protein embedded in the plasma membrane, or it may move across the plasma membrane and bind to a receptor protein in the cytoplasm.

Explanation: I found this answer on quizlet

7 0
3 years ago
Read 2 more answers
Other questions:
  • A student swings his keychain around in a circle. What is the source of the centripetal force for this action?
    11·2 answers
  • How are Protozoa similar to animals?
    8·1 answer
  • What happens when an individual suffers a bacterial infection in his legs?
    13·2 answers
  • ________ is when a sperm enters an egg. Fertilization Implantation Meiosis Mitosis
    13·2 answers
  • Photochemical smog consists of
    5·2 answers
  • In chickens, black and white feathers are codominant. Cross a black-feathered chicken with a checkered (black and white) feather
    13·1 answer
  • Will give brainliest How would this change MOST LIKELY affect the various populations over time?
    5·1 answer
  • I’ll mark brainlist
    9·1 answer
  • The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence do
    6·1 answer
  • This flower has petals in
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!