1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
7

1. What were the biotic and abiotic factors in the ecosystem?

Biology
1 answer:
Stels [109]3 years ago
3 0

1. Living and non living things in an ecosystem are called biotic and abiotic factors respectively.

Living things include: plants, animals, microorganisms and non-living things include: sunlight, temperature, gases, water etc.

2. Ecosystem, population, biosphere, community.

You might be interested in
Going from the bottom to the top panels, what behavior likely increased among the animals?
Arisa [49]
D is gonna be your answer because the more animals the more competition for survival
8 0
2 years ago
Read 2 more answers
Differentiate between a spider's web and a bird's nest.​
Kruka [31]

Answer:

one is made of silk and one is made from branches and anything to keep it together and for padding

Explanation:

the spider makes the webs out of silk and it traps anything that goes through it. the birds make the nests from branches and litter.

5 0
4 years ago
I am asking this again, but please help me on BIOLOGY! This might have multiple answers so please help. I’m confused :’(
ss7ja [257]
The best answer would be mRNA.
4 0
3 years ago
Read 2 more answers
DNA and protein together form a complex called
mariarad [96]
They form a complex called chromatin
6 0
3 years ago
Read 2 more answers
A population _____ follows a period of _____. decline; overshoot increase; overshoot increase; scarcity scarcity; dieback
Anna11 [10]

Answer:

Hey there!

A population increase follows a period of scarcity.

With more people, the food and water resources get scarce, and isn't always enough for everyone.

Let me know if this helps :)

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which example is most likely an organic compound? water, which is a liquid found all over Earth glucose, which is a sugar made b
    10·2 answers
  • 1.
    12·1 answer
  • Female cones produce what? Which contain eggs
    12·2 answers
  • Which of the following lists includes only quantitative data? * 50 ml water, water pH= 7.5, temperature= 87°F murky water, purpl
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How are l actic acid formation and alcohol fermentation different from each other?
    7·1 answer
  • During prophase in both mitosis and meiosis, chromosomes condense. At this time, identical copies of chromosomes are connected.
    15·1 answer
  • HURRY HELP !!
    9·2 answers
  • What is the porosity of the sand sample?<br> A)<br> 99%<br> B)<br> 72%<br> C)<br> 34%<br> D)<br> 16%
    9·2 answers
  • PLZ HELP FREE BRAINLIST!!!!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!