1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
victus00 [196]
2 years ago
11

Muscular tissue has several important properties, such as electrical excitability. Another property of muscular tissue is that i

t is able to stretch, and return to its original size and shape. Which property of muscular tissue is this
Biology
1 answer:
kifflom [539]2 years ago
4 0
Differentiated Muscular tissue that is able to do this varies in their concentration and or their abundance of sarcomeres and their filaments.

This priority is referred to as Elasticity.
You might be interested in
Which of the following statements is correct? a)All animals share a common ancestor. b)Sponges are diploblastic animals. c)Eumet
Alecsey [184]

All animals share a common ancestor.  

Explanation:

According to various phylogenetic gene sequence analysis, there are various evidences that proved all animals originated from a common ancestor.

Initially, it was stated that all organisms descended from a single cell which then gave rise to multicellular organisms. Organisms that descend from a common ancestor are closely related and grouped.

The lineage of the common ancestor can be traced in the neoproterozoic era.

The last common ancestor or the basal animal was sea sponge according to some researchers. The last universal common ancestor is called as the concestor.  

6 0
2 years ago
All but one of the girl's traits are determined by her chromosomes. that is
dolphi86 [110]

Out of the following given choices;

A) her sex.

B) how tall she is.

C) how long her hair is.

D) the color of her eyes.

The answer is C. The length of hair is not determined by genetics but rather by the time period of the growth phase (anagen phase) of the hair follicle, before shedding in the telogen phase. The longer the anagen phase the longer the hair will be before shedding. The hair on the head has longer anagen phase compared to hair in regions such as the eyebrows.






5 0
2 years ago
Read 2 more answers
Question 1 of 10 Which type of thermal energy transfer warms your hand when you hold it near a glass of hot water? O A. Radiatio
horrorfan [7]
B convention oooooolookooo
5 0
2 years ago
In drosophila the gene for eye color is located on ____.
MaRussiya [10]
In drosophilia, the gene for eye color is located on the x chromosome.
3 0
2 years ago
What are the constants for the above scenario?
Serjik [45]

Answer:

what scenario, nothing is there

8 0
2 years ago
Other questions:
  • Extremely high temperatures and pressures are necessary for fusion reactions to take place in stars. Please select the best answ
    9·2 answers
  • Katrina has low levels of leukocytes in her body. Which is most likely her health concern?
    11·1 answer
  • What is speciation?
    7·2 answers
  • What events occurs during transcription?
    13·2 answers
  • Anisogamy (different-size gametes) is a phenomenon found in many sexually reproducing species. Which of the following assumption
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • PLS HELP! WILL GIVE BRAINLIST!
    14·1 answer
  • An energy pyramid is a graphical model of energy flow in a community. The different levels represent different groups of organis
    8·2 answers
  • Question is inside the image below.
    11·1 answer
  • Which choice below has the South American natural resources
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!