True they did won the battle is true because I just looked it up
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
From the perspective of human health, here are the three inhuman farming practices that need to change:
- <u>
Using Antibiotics and hormone</u> to encourage high-yielding animals. The overuse of antibiotics in food-producing animals increases in resistant bacteria and when these bacterias are passed to humans they can cause serious illness.
- <u>Cage hen</u>: to save space the animal are crammed together in cages typically indoors, space where they can barely move around. Cage hen's eggs have fewer nutrients than free-range eggs
- <u>Factory farming</u> is an industrial facility that raises large numbers of farm animals. This factory farming creates waste that contains highly concentrated chemical and bacterial toxins. It contaminated the water and the air that cause illnesses in humans such as brain damage and depression to miscarriage and birth defects
<h3>Further Explanation
</h3>
Inhumane farming methods is a practice where animals are treated as a commodity to increase their productivity. The word inhumane means cruel and heartless. Animals are treated badly, crammed together with little space, limited or no natural light or stimuli and preventing them from normal behaviors such as nesting or foraging. Animals are suffering because of these unnatural and inhumane conditions.
Inhumane farming methods not only bad for the animal but also bad for human health. This method creates other health hazards because of the over-crowded condition and stressful animal which makes it easy for disease to spread.
<h3>Learn more
</h3>
Humane farming practices brainly.com/question/1645962
Humane farming brainly.com/question/4926360
Keywords: inhumane farming methods, factory farming, health hazard, cage hen
