1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesya692 [45]
3 years ago
14

What was

Geography
1 answer:
Llana [10]3 years ago
5 0

Answer:

According to researches, the Native population in Americas before the arrival of Europeans was around 100 million people, while some are estimating that it was even more.

Explanation:

Before Europeans arrived in America, many native culture were developing and some were even at their peak.

But when the conquistadores came, they killed a lot of them, while a lot of them died due to diseases that were brought by Europeans.

The population in just a couple of decades fell from 100 millions to just a couple of millions.

You might be interested in
Which of the following is a traditional economic practice in Africa?
FromTheMoon [43]
Herding? sorry if it’s not right
5 0
2 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which part of a map would you look at to find directions on a physical map?
viva [34]

Answer:compass rose

Explanation:

6 0
3 years ago
Read 2 more answers
Someone please help answer these questions
lakkis [162]

Answer

.

Explanation:

.

5 0
3 years ago
Other researchers have been investigating another potential link between global climate change and ragweed allergies. They hypot
AveGali [126]

Answer:

First it is important to clarify that your question is incomplete, I do not see the graph you are talking about ..

Although faced with the situation, I took the trouble to investigate in medical pages on this subject, and I conclude that the hypothesis of the doctors is correct ...

Because greater global warming, lower partial pressures of oxygen in the atmosphere (therefore those people who had difficulty breathing will be more affected), greater pollutants in the environment (greater hypersensitivity reactions in allergy sufferers), and the seasons of Heat spread, therefore the pollination processes also and it is there where there is connection with allergies due to ragweed.

Explanation:

Allergies are increased immunological reactions against an antigen, so I added to your question that ambrosia pollen generates more allergies in the respiratory tract than at the cutaneous level, that is why it cooperates with other alterations that environmental contamination generates.

The greater the contamination, the greater the presence of allergies or the longer the allergies will be.

5 0
3 years ago
Other questions:
  • Which of the following regions is MOST likely to have countries in Stage 4 of the demographic transition?
    15·1 answer
  • 2. Explain why 'recycling' is used to describe<br> the process of the tectonic plates.
    9·1 answer
  • How does fast-moving cold air create thunderstorms when combined with warm air?
    15·1 answer
  • What is Geology?Need to know and thank you!
    11·1 answer
  • A definition for meter
    15·2 answers
  • Which of the following was a Spanish colony but is now a U.S. commonwealth?
    6·1 answer
  • <img src="https://tex.z-dn.net/?f=%20%5Cunderline%7B%20%5Cunderline%7B%20%5Ctext%7BQuestion%7D%7D%7D%20%3A%20" id="TexFormula1"
    13·1 answer
  • The Mississippi River is __ of Washington, DC. north south east west<br> PLZ HELP
    5·1 answer
  • Please help and thank you
    13·1 answer
  • The expression 8y+9 made up___term a.one b.two c.three d.four​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!