1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
12

Select the correct sequence of steps as energy is extracted from glucose during cellular respiration.

Biology
1 answer:
White raven [17]3 years ago
8 0

Answer:

a.glycolysis   d.acetyl CoA   b.citric acid cycle   e.electron transport chain

Explanation:

Cellular respiration is set of metabolic processes that occur within the cell in order to produce usable energy (ATP) from the nutrients (food). It can be divided into four main stages:

  1. Glycolysis-anareobic process in which glucose is broken down and it occurs in the cytoplasm.  Products of glycolysis are 2 molecules of pyruvate and 2 molecules of ATP.
  2. Transition- Pyruvate form the glycolysis  is transported into the mitochondria, where it is converted to a molecule  Acetyl CoA used for further breakdown
  3. Citric acid cycle or Krebs cycle- aerobic  process that occurs in the mitochondria matrix in which 4  molecules of ATP, and  NADH are produced
  4. Electron transport chain-set of reactions that occur within the cristae of mitochondria. NADH and electrons are passed  through electron transport chain to result in the production of ATP (32 ATPs for every glucose).
You might be interested in
How do the circulatory and respiratory system interact to provide muscle cells with oxygen during a long distance race?
Orlov [11]

Answer:

Humans—and other complex multicellular organisms—have systems of organs that work together, carrying out processes that keep us alive.

The body has levels of organization that build on each other. Cells make up tissues, tissues make up organs, and organs make up organ systems.

The function of an organ system depends on the integrated activity of its organs. For instance, digestive system organs cooperate to process food.

The survival of the organism depends on the integrated activity of all the organ systems, often coordinated by the endocrine and nervous systems.

Explanation:Goblet cell in your respiratory epithelium of trachea.

3 0
3 years ago
Which statement is true of both active transport and facilitated diffusion?
enyata [817]

The correct answer is option (D) The active transport and the facilitated diffusion both involve the proteins present in the cell membrane.

Facilitated diffusion transport the large and the charged molecules through the protein transport channels present in the cell membrane. In this case, the solute move from a region of higher concentration to lower concentration and it does not require energy.

Active transports takes place when the molecules move from a region of lower concentration to higher concentration via the membrane protein channels.

Both facilitated diffusion and active transport requires the proteins present in the cell membrane.

7 0
3 years ago
Why do second answers get the most attention?
ICE Princess25 [194]

Explanation:

Because people who answer first tend to rush their answers and not do a clear explanation, they often get less recognition than the second person, who usually puts more effort into their answer. The example you gave is an example for that, as the second person has an explanation and more words.

3 0
2 years ago
Read 2 more answers
A structure in the leg of a human is found to carry oxygen-rich red blood cells. What else is most likely true about this struct
Gwar [14]
Most likely to be A which is probably an artery which carries blood away from the heart Nd tens to carry oxygen rich blood

the leg doesnt contain aveoli this is found in the lungs so its not B
since its oxygen rich little carbon dioxide will be present in this structure so its not C
this part cant be part of the respiratory system as the respiratory system includes lungs, mouth and etc but not the legs so it cant be D

hope that helps
8 0
3 years ago
Read 2 more answers
(Apoptosis is? ) A)cancerous cells
sasho [114]
Apoptosis is programmed cell death. The body is this to get rid of unneeded or abnormal. The body will get rid of cells with damaged DNA before they can become cancerous.
7 0
2 years ago
Read 2 more answers
Other questions:
  • Most of europe is located in the tropics (between the tropic of cancer and tropic of capricorn).
    10·1 answer
  • all of the triplet codes needed to produce a specific polypeptide chain are found in a(n)____________.
    6·1 answer
  • What are body systems composed of ​
    15·1 answer
  • An organism on which a parasite or virus lives is called a . pleaseeeeee hurry
    11·2 answers
  • Which action is most likely to stop succession and make an ecosystem less
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Choose the best response on how sea otters and sea turtles deal with the salty ocean.
    14·1 answer
  • Please help anyone ?????!!!
    8·1 answer
  • Why is chlorophyll important in the process of photosynthesis?
    6·1 answer
  • Help pls! The chart below shows the primary energy production methods in two locations.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!