1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrews [41]
4 years ago
6

How many trips has Earth made around the Sun in 8 mar years

Biology
1 answer:
alex41 [277]4 years ago
3 0

The answer is;  15 years

It takes 687 days for mars to orbit the sun once. 8 mars years would, therefore, mean;

8 * 687 = 5496 days

The earth takes 365 days to orbit the sun  once. Therefore, the earth will orbit the following number of times in 8 Mar years;

5496/365 = 15.058

Which is approximately 15 years


You might be interested in
Which experiment has the most reliable results?
Katyanochek1 [597]

Answer:

I would think C, if it is consistent then the results should be reliable!

Explanation:

3 0
3 years ago
A scientist is studying an acidic pool that contains large amounts of iron, SO4, CO2, and O2. Use the chart at the station to id
poizon [28]

Answer:

Acidophilic and acidotolerant eukaryotic microorganisms such as algae, amoebas, ciliates, heliozoan and rotifers, not to mention filamentous fungi and yeasts.

Explanation:

Acidophilic and acidotolerant eukaryotic microorganisms such as algae, amoebas, ciliates, heliozoan and rotifers are the organisms which can survive in highly acidic solution that have large amounts of iron, sulfur dioxide, carbondioxide, and oxygen molecule. In these organisms algae is autotrophic whereas archaea, bacteria, fungi, yeasts and protozoa are heterotrophic.

8 0
3 years ago
Read 2 more answers
What is the relationship between genes and chromosomes?
ANTONII [103]
I'm pretty sure the answer would be A. Chromosomes contain one or more genes.
7 0
4 years ago
Read 2 more answers
Identify the biotic limiting factor from the choices below.. a.space. b.vegetation. c.water. d.climate
Digiron [165]
Limiting factors are what controls the population of an ecosystem. It also limits the kind of organisms that inhabit it. Limiting factors can be abiotic or biotic. Abiotic factors are the nonliving factors that affect the living ones. From the given options above, the only biotic limiting factor is vegetation. The correct answer would be option B.
4 0
4 years ago
Read 2 more answers
Two parents who do not have sickle cell anemia have a child that has the disease. The parents are both:_______
Mars2501 [29]

Answer:D

Explanation:

Both parent are Heterozygous for the sickle cell allele.

Both parent have sickle cell trait in which the both posses one abnormal allele of the hemoglobin beta gene (AS heterozygous genotype)

When two AS parents mate, probability of giving birth to a sickle cell anemia child is 1/4

AS + AS= AA, AS, AS, SS

6 0
3 years ago
Other questions:
  • In Garden peas, tall vine is dominant and short vine is recessive. If a homozygous tall plant is crossed with a homozygous short
    12·2 answers
  • The type of contraction that changes a skeletal muscle's length is called
    6·2 answers
  • Some bears kept in captivity allow veterinarians to routinely give them total body checkups. these bears open their mouths for t
    15·1 answer
  • Why is it important for signal transduction systems to trigger a rapid response within a cell and be able to be shut down quickl
    15·1 answer
  • Danica builds a model of human lungs in biology class using a plastic bottle, scissors, two small balloons, one large balloon, a
    12·1 answer
  • Williamson synthesis 2-propoxypropane from propene
    13·1 answer
  • Which statement accurately describes the function of a hormone produced by the adrenal gland
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is the ingroup in a cladogram?
    6·1 answer
  • Fill in the blank pls help
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!