1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
4 years ago
11

Can i have a mini lesson on evolution

Biology
2 answers:
OleMash [197]4 years ago
6 0
Evolution is when (happens when) organisms evolve to adapt to their environment so they can survive.

Example: Humans have a shared common ancestor with apes, we used to be hairy but have less hair due to the less need of warmth. (Air conditioning , heaters in homes...)
kobusy [5.1K]4 years ago
4 0

Go on Google you will get a good explanation.

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
How is climate change threatening the availability of sea ice?
nlexa [21]

Answer:

The glaciers are melting and sea levels are rising

3 0
4 years ago
Spinal Nerve
lubasha [3.4K]
If I’m not mistaken, I think B. Is the answer because the nerves in your spinal cord send signals from your brain into the rest of your body. So I think the answer is B. Hope this helps.
3 0
3 years ago
Ayudaa
fredd [130]
The correct answer is 30:(
7 0
3 years ago
1) which color has the longest wavelength?
Karo-lina-s [1.5K]

1- Red color has the longest wavelength. Red light belongs to the visible spectrum of light and the wavelength of visible spectrum ranges from 700nm to 400nm, from red to violet respectively.

2- Gamma rays, x-rays, visible light and radio waves are all types of electromagnetic radiations. Electromagnetic radiations contain visible light, radio waves, gamma rays and x-rays. These radiations has varied electric and magnetic fields.

3- The fact that light can exert a pressure on matter suggests that it is made up of photons.


5 0
4 years ago
Read 2 more answers
Other questions:
  • List the phases of mitosis in order and state what major events take place during each phase (include interphase)
    6·1 answer
  • How do I trust take in mass in the form of food. Food is either used to build molecules within the body or as a fuel for cellula
    8·2 answers
  • In 1980, a group of scientists from The University of California at Berkeley found an unusually high concentration of iridium in
    9·1 answer
  • Why do phospholipids form a bilayer in water?
    12·2 answers
  • Help!! I need to do this asap.
    13·1 answer
  • As a population increases, so does household waste. The most environmentally friendly, and also realistic, solution to this stat
    15·1 answer
  • Q. Which method of determining age is more specific?
    14·1 answer
  • Which of the six kingdoms absorb nutrients from their surroundings?
    9·2 answers
  • Which process is best illustrated by the diagram?
    7·1 answer
  • The vibrations received by the tympanic membrane are transferred to the oval window by the?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!