Answer:
As lionfish populations grow, they put additional stress on coral reefs. For example, lionfish eat herbivores, and herbivores eat algae from coral reefs. Without herbivores, algal growth goes unchecked, which can be detrimental to the health of coral reefs.
Explanation:
The US Environmental Protection Energy or EPA is responsible for ensuring the country's drinking water to be safe and with good quality. It is in the Safe Drinking Water Act of 1974 that reclaims in ensuring the purity of drinking water Americans drink. Under the said Act, every citizen has his/her own roles and responsibilities. However, the implementation of such is governed by the EPA.
Binary ionic compounds are named in the pattern of metal, then nonmetal.
I hoped this helped.
Warmblood mares that were pregnant (n = 10) had their peripartum alterations in blood pressure, heart rate, complete blood count, plasma electrolyte concentrations, and heart rate variability (HRV) assessed.
<h3>What is Gestation ?</h3>
The time during which an embryo, and eventually a fetus, develops inside viviparous animals is known as the gestational period. Although certain non-mammals also experience it, it is usual for mammals. When mammals are pregnant, they may have one or more gestations concurrently, as in the case of multiple births.
<h3>What is peripartum period ?</h3>
The time just prior to, during, and soon following childbirth.
Everyone agrees that the postpartum period starts when the baby is born. Although the end is less well defined, it is sometimes thought to occur six to eight weeks after delivery because by then the effects of pregnancy on many systems have essentially gone back to their pre-pregnancy states.
To know more about Gestation please click here : brainly.com/question/14927815
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: