1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dangina [55]
3 years ago
14

Which process is involved in growing crops?

Biology
1 answer:
Temka [501]3 years ago
8 0
Irrigation
Preparation of soil is the first step before growing a crop
You might be interested in
State the peripheral nervous system. Write the answer from own words.
Crank

Answer:

The peripheral nervous system (PNS) consists of all the nervous tissue that lies outside of the central nervous system (CNS).

Explanation:

6 0
3 years ago
Read 2 more answers
Help me please I need it!!!
sweet-ann [11.9K]

Answer:

Explanation:

I would say that your answer would be A.) seeds. Plants don't even have reproductive organs, so that answer would be a definite no. Pollen and nectar comes from both trees and flowers, not fruit. So, that would make your answer seeds.

3 0
3 years ago
Read 2 more answers
Will give brainliest!!!!!! pls explain the student decides that measuring the amount of co2 produced will determine the total ra
myrzilka [38]

The student could measure only the rate of anaerobic respiration by measuring the carbondioxide gas concentration.

<h3>How to measure the rate of anaerobic respiration?</h3>

In the absence of oxygen, yeasts convert glucose into ethanol and carbon dioxide. This rate of carbon dioxide is used to measure of the overall rate of anaerobic respiration.

So we can conclude that the student could measure only the rate of anaerobic respiration by measuring the carbondioxide gas concentration.

Learn more about respiration here: brainly.com/question/22673336

5 0
3 years ago
Anyone got the answers to this worksheet?
Marrrta [24]

Answer:

it tells you all the answers

Explanation:

3 0
3 years ago
Which group has three unpaired electrons in its p orbital
Margarita [4]
<span>Electrons that are unpaired are involved in bonding or pairing with another atom. Valence electrons can be unpaired. Once the electrons are paired the atom is in a more stable state.
</span>
6 0
3 years ago
Other questions:
  • What is inside a bacteriophage
    5·1 answer
  • As compared to babies of healthy mothers, babies whose mothers suffered from certain infections when they were pregnant were ___
    14·1 answer
  • Which of the following organic molecules may have up to four levels of structure?
    5·1 answer
  • Can eating massive amounts of raw rhubarb kill your taste buds?
    14·1 answer
  • This bonds to guanine (G) in DNA.
    13·2 answers
  • What is hard water? what cause hardness of water?
    8·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Desalination is an important process when it comes to seawater. What are some positive effects of desalination?
    9·1 answer
  • What genotype must all dwarf babies have? *
    5·1 answer
  • ​Why do knuckles crack when you bend them
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!