1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
13

Even though her parents insist that a high school sophomore should be in bed by 9:30 on weeknights, Nadine finds it hard to get

to sleep until at least 11:00. This is likely due to an increase in her levels of:
Biology
1 answer:
azamat3 years ago
8 0

Answer:

Melatonin

Explanation: melatonin in the body is a natural hormones that helps in the regulations or coordination of the cycle of our sleeping and waking. It is found in the pineal glad and it is more active during night time than day time.

Teenagers most especially has different time of sleep they sleep mostly late during weekends and sleep early during weekdays.our body needs sleep so as to function properly and most times our body is also adapt to some times that we sleep. Melatonin is usually release in the body gradually around 9pm in the evening where it initiate sleep but in some people, it is when the hormones is release in an increase dose that they can fall asleep thereby shifting the time to about 11pm or 12pm before the person can fall asleep for quick sleep, melatonin supplement are used.

You might be interested in
Carbohydrates are the primary source of energy for the huma
Xelga [282]

Answer:

Ambitious

If your body lacks enzymes that break down

carbohydrates, it would be unable to get sugar molecules for energy production.

If you lacked the enzyme to digest proteins, you may not absorb enough amino

acids.

The digestive system in our body changes

carbohydrates into glucose; also known as blood sugar to be use as an important

source of energy. Meanwhile, amino acids are organic compounds that combine to

form proteins, which are the building blocks of life.

3 0
3 years ago
Which of the following are formed during photosynthesis?
Brrunno [24]

During photosynthesis, plants take in carbon dioxide (CO2) and water (H2O) from the air and soil. Within the plant cell, the water is oxidized, meaning it loses electrons, while the carbon dioxide is reduced, meaning it gains electrons. This transforms the water into oxygen and the carbon dioxide into glucose. The plant then releases the oxygen back into the air, and stores energy within the glucose molecules.

Explanation:

3 0
4 years ago
PLZ TELL ME YOUR ANIME SHIPS
Fudgin [204]

Answer:

i ship ray and emma from the promised neverland. i did ship her and norman but y'know

Explanation:

4 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which of the following enzymes is not involved in DNA replicaiton?
Hitman42 [59]

Answer:

Enzymes involved in DNA replication are:

<em>Helicase</em> (unwinds the DNA double helix)

<em>Gyrase</em> (relieves the buildup of torque during unwinding)

<em>Primase</em> (lays down RNA primers)

<em>DNA polymerase III</em> (main DNA synthesis enzyme)

<em>DNA polymerase I </em>(replaces RNA primers with DNA)

<em>Ligase </em>(fills in the gaps)

So the correct answer would be <em>RNA polymerase</em>

Hope I could Help :)

6 0
4 years ago
Other questions:
  • Cells that have a nucleus are called what
    13·2 answers
  • Designing and constructing buildings that are energy efficient, economical, and made of recycled materials, is a trend called
    15·1 answer
  • The rate at which materials enter and leave the cell depends on the cells
    11·1 answer
  • A measure of the amount of output produced by a given amount of inputs in a specific period of time is the definition of
    5·2 answers
  • Well, do anyone know this answer it'll help a lot
    8·1 answer
  • Answer the following question about the generalised photosynthesis equation: 6CO2 + 6H2O ---&gt; C6H12O6 + 6O2
    9·2 answers
  • Animal cells are surrounded by a(n) ________________, whereas plant cells are also surrounded by a(n) ________________ .
    13·1 answer
  • Any body part attached to a main structure is called a(n) ligament. appendage. tendon. epiphysis. fontanel.
    8·1 answer
  • Imagine that a human skin cell went through mitosis but did not undergo cytokinesis. how many chromosomes would be in the cell?
    6·1 answer
  • The reason cows belch methane gas and humans do not is because ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!