Answer:
Ambitious
If your body lacks enzymes that break down
carbohydrates, it would be unable to get sugar molecules for energy production.
If you lacked the enzyme to digest proteins, you may not absorb enough amino
acids.
The digestive system in our body changes
carbohydrates into glucose; also known as blood sugar to be use as an important
source of energy. Meanwhile, amino acids are organic compounds that combine to
form proteins, which are the building blocks of life.
During photosynthesis, plants take in carbon dioxide (CO2) and water (H2O) from the air and soil. Within the plant cell, the water is oxidized, meaning it loses electrons, while the carbon dioxide is reduced, meaning it gains electrons. This transforms the water into oxygen and the carbon dioxide into glucose. The plant then releases the oxygen back into the air, and stores energy within the glucose molecules.
Explanation:
Answer:
i ship ray and emma from the promised neverland. i did ship her and norman but y'know
Explanation:
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Enzymes involved in DNA replication are:
<em>Helicase</em> (unwinds the DNA double helix)
<em>Gyrase</em> (relieves the buildup of torque during unwinding)
<em>Primase</em> (lays down RNA primers)
<em>DNA polymerase III</em> (main DNA synthesis enzyme)
<em>DNA polymerase I </em>(replaces RNA primers with DNA)
<em>Ligase </em>(fills in the gaps)
So the correct answer would be <em>RNA polymerase</em>
Hope I could Help :)