1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavel [41]
3 years ago
11

What is the brain? Pleas help

Biology
2 answers:
svetlana [45]3 years ago
6 0
;The brain is protected by your skull, and is an organ of soft nervous tissue. It has multiple parts that are the cerebrum,cerebellum, hypothalamus, brain stem, and a medulla. There are other parts, these are the most known parts.
Kaylis [27]3 years ago
4 0
The brain is an organ in your head, protected by your skull. It allows you to doall essential tasks.
You might be interested in
Which limiting factor would decrease the carrying capacity of any ecosystem without it?
Anna [14]
It’s A I took the quizz
7 0
3 years ago
Is the preferred form of energy cells use to power celular processes.
love history [14]

Answer:

ATP

Explanation:

3 0
3 years ago
Read 2 more answers
Crossing over shuffles alleles on:_____.a. sister chromatids.b. different non-homologous chromosomes.c. chromosomes within diffe
drek231 [11]

Answer:

d

Explanation:

<em>Crossing over shuffles alleles on non-sister chromatids of homologous chromosomes.</em>

At the prophase I stage of meiosis, homologous chromosomes synapsed to form a four-chromatid structure known as tetrad. Exchange of chromosomal segments between non-sister chromatids of the tetrad then takes place, a process that results in the reshuffling of genes or alleles on the non-sister chromatids.

Hence, none of the answers is correct.

Correct option: d

6 0
3 years ago
Electrons are transferred in the formation of ______________ bonds. A) ionic B) covalent C) metallic D) all chemical
Sveta_85 [38]

Answer: A. ionic

In ionic bonds electron are transferred from one atom to another. In ionic bonds , the metal atom loses electrons to become positively charged cation whereas the nonmetal atom accepts those electrons to become negatively charged anion.

5 0
3 years ago
Read 2 more answers
What do enzymes do within cells?
sleet_krkn [62]
They are proteins inside the cell
5 0
4 years ago
Read 2 more answers
Other questions:
  • Chemical bonds found in living systems do not normally include __bonds
    5·2 answers
  • What is photosynthesis​
    9·2 answers
  • Anthropologists accept a theory when __________.
    15·1 answer
  • In algae and plants, photosynthesis happens in the
    8·2 answers
  • Spinal nerves exiting the cord from the level of l4 to s4 form the
    8·1 answer
  • Unlike secondary succession, primary succession
    13·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • What will happen to plant cells if there were no plasmodesmata?
    6·1 answer
  • Which of the following is BEST definition for world debt?
    6·1 answer
  • The peripheral nervous system is involved in
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!