1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
3 years ago
8

A city spends $15 million on a beach nourishment project that adds 1.8 million cubic yards of sand to 3 miles of beach. What is

the cost per cubic yard of sand?
Biology
1 answer:
k0ka [10]3 years ago
8 0

Answer:

The answer is $8.33 per cubic yard.

Explanation:

This problem is just a normal math equation. You divide the price by how much space you are covering to get the smallest ratio(15 million divided by 1.8 million). After dividing you get the answer of $8.33 per cubic yard.

You might be interested in
Peat is soil that is composed of
svp [43]

Answer:

Peat is the surface organic layer of a soil that consists of partially decomposed organic matter, derived mostly from plant material, which has accumulated under conditions of waterlogging, oxygen deficiency, high acidity and nutrient deficiency

Explanation:

so c

7 0
3 years ago
----- production is the business of breeding, raising, and transporting livestock
earnstyle [38]
The production is a livestock as well with the business company transporting every items
6 0
4 years ago
Exponential growth is when a couple has the number of children to replace themselves.
Jobisdone [24]

Answer:

False

Explanation:

Exponential growth is when there is a rapid growth in the population

5 0
3 years ago
How should a microscope be carried
konstantin123 [22]
You put one hand on the bottom of the microscope then, you put the other hand on the backside of it (just underneath the slide part).
5 0
4 years ago
I am stuck on this question. "Viruses are considered to be which of the following?" (This is multiple choice)
rusak2 [61]
Viruses are actually smaller than bacteria but they're not bacteria. So D is wrong.

Viruses don't grow and aren't made of cells, and despite being able to reproduce, they're not living. So C is correct.

As for the other two, I'm not entirely sure what they mean but C is the answer.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which DNA or RNA consists of a single copy of a gene
    5·2 answers
  • A person who is infected with a pathogen who does not show symptoms is called a(n)
    11·1 answer
  • A diagram that compares energy use among trophic levels
    10·2 answers
  • You can float a paperclip on top of water if you very carefully place it flat on the water surface because of the molecular skin
    13·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which statement correctly compares metaphase I and metaphase II?
    9·1 answer
  • LUUL<br> 18. Gametes are produced during
    9·2 answers
  • A jack rabbit’s powerful leg is an example of a <br> Structural <br> Functional <br> Behavioral
    11·1 answer
  • A new predator of rabbits has been introduced within an ecosystem. This new predator runs faster than the native predators of ra
    13·2 answers
  • Strands of genetic material floating in the nucleus are refered to as_____
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!