1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuri [45]
3 years ago
12

Which of the following two cycles are the most closely related in their role in sustaining life?

Biology
1 answer:
Helga [31]3 years ago
7 0
Carbon and oxygen are the two cycles are the most closely related in their role in sustain life.
You might be interested in
Which of these elements are the least dense?
Monica [59]

Answer:

4.Silicon and Magnesium

Explanation:

5 0
3 years ago
When DNA is replicated, the original molecule serves as a(n) _____.
egoroff_w [7]
The answer would be B) Template

I hope that helps ^-^
6 0
3 years ago
Read 2 more answers
When a muscle cell demands energy to contract, what happens to ATP?
SOVA2 [1]
B. ATP is hydrolyzed and turns into ADP

ATP --> ADP + P = HYDROLYSIS
ADP + P --> ATP = PHOSPHORYLATION

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
A patient complains of difficulty passing stools, which are small, hard lumps. according to the bristol stool form scale, what w
Elenna [48]
Type 1 stools are detached, hard lumps that be similar to nuts that are tough to pass. Type 3 stools are like a sausage, but with pops on the surface. Type 5 stools are mushy blobs with clear-cut ends that are passed effortlessly. Type 6 stools are cottony pieces with raggedy edges.
8 0
2 years ago
Other questions:
  • Proper use of a condom during sexual activity does not guarantee protection against stis.
    14·1 answer
  • A cylinder with a mass of 12 g has a radius measuring 2 cm and a height of 6 cm. What is its density? 0.05 g/cm3 0.16 g/cm3 1 g/
    12·2 answers
  • Someone help me plz
    10·1 answer
  • The internal processes of ___________ enables living things to survive changing conditions.
    10·1 answer
  • PLEASE HELP ITS BIOLOGY
    15·2 answers
  • An mRNA containing information from more than one gene.
    6·1 answer
  • When the people in your social envirnment are supportive caring and respectful you are likely to feel to them?
    11·1 answer
  • Are the anomalies the same thickness along all ridge segments Why or why not?<br> plz help :D
    11·1 answer
  • Energy from food must be transformed into the bonds of
    13·1 answer
  • which could take place by active transport A. the movement of carbon dioxide into a photosynthesising leaf B. the movement of ca
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!