1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
3 years ago
6

a. Hypothesize the mode(s) of selection exerted by wasps on gall size of Eurosta. Explain your rationale. b. Hypothesize the mod

e(s) of selection exerted by birds on gall size of Eurosta. Explain your rationale. c. Hypothesize the mode(s) of selection exerted by beetles on gall size of Eurosta. Explain your rationale.
Biology
2 answers:
Phantasy [73]3 years ago
4 0

Answer:

The induction of galls in plants represented both morphological and physiological modifications of plant organs and tissues caused by endophage insects.

In the case of wasps, the relationship they have is of parasitic coexistence, therefore the gills become smaller.

 On the other hand, with birds the relationship is different since sometimes they usually feed on gills, their size is larger.

As for beetles, the size is intermediate.

Explanation:

The natural selection and the environment of the gills is what makes the size of said living being, this theory can be explained by means of the principles that Darwin proposed with the evolutionary theory.

 

Svetllana [295]3 years ago
4 0

Answer:

a. Modes of selection exerted by wasps: <u>directional (positive) and stabilizing</u>

If the galls are small in size, wasps are able to penetrate through and easily feed off of it. Hence, an average or large gall size of Eurosta is more likely to survive. 

b. Modes of selection exerted by birds: <u>directional (negative) and stabilizing</u>

Birds will get attracted to large sized galls. Hence, the average and smaller sized galls of Eurosta are more likely to survive 

c. Mode of selection exerted by beetles: <u>disruptive</u>

Beetles favor feeding on the average sized galls of Eurosta. Hence, the two extreme sizes - small and large galls of Eurosta - are more likely to survive. This will give two peaks if allele frequencies are plotted on a graph.

You might be interested in
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
How much space is there between particles of frozen water?
denpristay [2]

Explanation:

When water turns to ice, it expands/contracts

The (molecules) in water is more tightly packed than in ice, so water has greater density than ice. Don't let the fact that ice is a solid fool you!

6 0
3 years ago
Brainlest please answer!!
Oduvanchick [21]

Image result for Compare and contrast intracellular vs. intercellular communication

The key difference between intracellular and intercellular signaling is that intracellular signaling is the communication within the cell while intercellular signaling is the communication between cells. ... Also, within the cell, communication occurs between organelles and nucleus to carry out cellular functions.

3 0
2 years ago
Can someone help me? I don’t understand this.
Anarel [89]

Answer:

dude bottom is right

Explanation:

3 0
3 years ago
What does rna polymerase bind to in order to initiate transcription?
quester [9]

Answer:RNA polymerase binds to a sequence of DNA called promoter found near the beginning of the gene

Explanation: each gene has it own promoter. Once bound, RNA polymerase seperates the DNA strands, providing the single-stranded bind needed for transcription

3 0
3 years ago
Other questions:
  • What is the relationship between the golgi apparatus and the er?
    8·1 answer
  • Which element of the scientific process includes the most specific type of information about a living thing?
    6·1 answer
  • How do plants absorb light energy from the sun?
    15·2 answers
  • Heyyyy! I need some help. Could ya lend me a MOUSE?? Haha, get it? Cause we can't see each other, then at least you can use the
    6·1 answer
  • Which adaptation is unique to insects among all protostomes?
    15·2 answers
  • Which of the following functions is associated with the blood?
    15·1 answer
  • Rain forests cover just 6 percent of the Earth’s land surface, yet they contain _____ percent of Earth’s species. 30 60 70 40
    6·2 answers
  • What is shown in the image below?
    5·1 answer
  • I am a semi-permeable layer around the cell that encloses the contents of the cell. What am I? *
    7·1 answer
  • If mitosis happens in our gonad cells that produce egg or sperm. How will it impact the progeny's chromosome number? Emphasize a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!