1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
3 years ago
7

Approximately what percent of the Earth’s surface is covered by ocean?

Biology
2 answers:
mestny [16]3 years ago
5 0

The percent of the Earth's ocean is 70%.

Katarina [22]3 years ago
3 0
Approximately 70 percent of the Earth is covered by water
You might be interested in
What BEST describes the role of water molecules in photosynthesis?
kolbaska11 [484]

Answer:

Light provides … Briana notices the electrons that the water molecules release.

6 0
3 years ago
The reaction occurs only at extremely high temperatures.<br> O Fusion<br> O Fission
Zanzabum

Answer:

fission

Explanation:

4 0
3 years ago
Read 2 more answers
In what direction do the cold waters of the artic (north) goin the atlantic ocean
Ulleksa [173]

Answer:

The cold, northern currents then flow in a rotating current system called the North Atlantic subpolar gyre, of which the Labrador Current is the southward flowing component.

                                                         OR

The Gulf Stream is an intense, warm ocean current in the western North Atlantic Ocean. It moves north along the coast of Florida and then turns eastward off of North Carolina, flowing northeast across the Atlantic.

Explanation:

Idk if this is right but hopefully it is...

7 0
3 years ago
Cooler places have
Sever21 [200]

Answer:

The answer is B lower pressure

Explanation:

because in cooler places its cold and warm mixed

6 0
2 years ago
Read 2 more answers
True or False <br> Ocean water, River water, and Well water are all types of surface water.
Vikki [24]
False. Well water is water that is stored underground and needs to be "dug" up from beneath.
7 0
3 years ago
Other questions:
  • What type of inheritance patterns are exhibited by the pedigree, and how are the affected genotypes created?
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is an example of the pattern of evolution? heredity descent with modification the inheritance of acquired
    11·1 answer
  • Which type of operon, an inducible one or a repressible one, would an organism likely use to produce enzymes and other proteins
    6·1 answer
  • Protein's structure formed by folding, coiling, and aggregation of polypeptides that is induced by distant residues in the chain
    14·1 answer
  • In cats, black fur color is determined by an X-linked allele; the other allele at this locus determines orange color. The hetero
    10·1 answer
  • The graph illustrates the relative activity levels of three common digestive enzymes, where 0 represents no activity and 12 rep
    11·2 answers
  • What is the name of the process where DNA is<br> duplicated to create two strands of DNA?
    10·1 answer
  • - Why was the shift to farming a big deal?
    11·1 answer
  • What do you already know about the rotation and the revolution of the Earth?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!