1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
14

If carbon dioxide is completly removed from a plants enviroment what would you expect to happen to the plants producution of hig

h energy sugars
Biology
1 answer:
Virty [35]3 years ago
5 0

Answer:

If carbon dioxide is completly removed from a plants environment, what would you expect to happen to the plants production of high energy sugars? The plant would not be able to produce its food, hence; death looms for the plant

Explanation:

You might be interested in
1: How does sea-floor spreading occur? A, New materials are being added to the asthenosphere.
marin [14]
1. <span>D. Molten material beneath Earth's crust rises to the surface.

2. </span><span>A. The mid-ocean ridges
(This is asking for what form. The Andes is a mountain range in Peru)

3. </span><span>C. Subduction causes the ocean floor to sink into deep ocean trenches.
(Subduction is when part of the ocean floor sinks under a deep-ocean trench and return the the mantle; this is caused by the movement of tectonic plates)

:)
</span>
4 0
3 years ago
Which unit is used to measure the forces that act on objects?
geniusboy [140]

Answer:

Newtons

Explanation:

4 0
3 years ago
BRAINLIEST IF RIGHT DUE IN 5 MINUTES A skydiver decides to test which parachute will make her fall faster. The mass of the first
Llana [10]

i have answer: if one of them weighed more than the other, but the other fell from a lower distance, then they would fall at the same time because the one that weighs more would go faster. if they weighed the same, the one from a lower distance would fall first because they are closer.

7 0
3 years ago
Read 2 more answers
During this phase of mitosis, the mitotic spindle forms and the nuclear envelope fragments.
Arisa [49]

Mitotic spindle forms and the nuclear envelope fragments at the prophase stage of mitosis.

<h3>What are the stages of mitosis?</h3>

Mitosis has 4 main stages that are more or less in a continuous spectrum. These stages are:

  • Prophase
  • Metaphase
  • Anaphase
  • Telophase

The prophase stage is characterized by the dissolution of the nuclear envelope, the condensation of chromatin materials, and the onset of spindle formation.

The metaphase stage is characterized by the alignment of chromosomes at the equator and the engagement of each chromosome by spindle fibers at the centromere.

The separation of sister chromatids characterizes the anaphase through the shortening of the spindle fibers from the opposite ends of the cell.

The telophase is characterized by the completion of the migration of sister chromatids to the poles.

Thus, the mitotic spindle forms and the nuclear envelope fragments at the prophase stage of mitosis.

More on mitosis can be found here: brainly.com/question/26678449

#SPJ1

3 0
1 year ago
The energy needed to "pump" sodium outside the cell in active transport is _____.
dolphi86 [110]

Adenosine triphosphate (also called ATP) is used by the cell as fuel to pump sodium out of the cell during the process of active transport. It carries energy to the areas of the body where it is needed. It is necessary for many of the cell's functions and is an important part of metabolism.



mark brainliest   :)

8 0
3 years ago
Read 2 more answers
Other questions:
  • The different degrees of sleep and wakefulness through which newborns cycle, ranging from deep sleep to great agitation, are cal
    15·1 answer
  • If there is a high concentration of reducing sugar, Benedict’s solution will turn _______. A. Green B. Orange C. Red D. Blue
    9·2 answers
  • The importance of homeostasis as it relates to the organism
    15·1 answer
  • Which of the following would be an important part of a multi-step plan to restore the stability of the red-cockaded woodpecker's
    10·1 answer
  • Frozen water (ice) has less density than liquid water.
    7·2 answers
  • What role does the heart play in helping the circulatory system perform its functions?
    12·2 answers
  • if the mass extinction event that had wiped out the dinosaurs had not occurred, could dinosaurs rather than mammals have evolved
    10·2 answers
  • What unit of time on Earth is based on the revolution of the Moon around the Earth?
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Is a ping pong ball a nonliving or living thing and why
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!