1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
8

What is a molecule ?

Biology
1 answer:
Delicious77 [7]3 years ago
4 0

A molecule is  two or more atoms held together by chemical bonds.

You might be interested in
When the moon orbits the Earth and the_____of the moon shines on the Earth we have a___eclipse.
MakcuM [25]

Answer:

Shadow, an d total

Explanation:

5 0
2 years ago
Which one of the following is a characteristic of a metal?
alex41 [277]
B) Most metals conduct heat readily. In pure elemental forms, they neither have basic or acidic properties. Other properties include malleability, high melting points, high densities, and electric conduction.
4 0
3 years ago
Read 2 more answers
A 6th grade class was presented with the following statement the amount of water on the surface of earth today is the same amoun
Paha777 [63]

Answer: It's true

Explanation:

The Water cycle. It continues on and on it doesn't stop.

5 0
3 years ago
Mayras maternal grandfather into maternal uncle died of heart attacks and her mother has high blood pressure. What answer best e
IRINA_888 [86]

Answer:

Mayra should be checked regularly for heart-related problems.

3 0
2 years ago
Which type of bone is indicated by the arrow? long irregular flat short
nlexa [21]

The answer is long

The bone indicated by the arrow is femur bone. It should be classified as the long bone. Other example for long bones would be tibia and fibula. Short bone would be carpal or tarsal bones. Flat bone could be found in skull. Irregular bone would be the vertebrae or pelvic.

8 0
2 years ago
Read 2 more answers
Other questions:
  • In what ways is the filtrate that enters the glomerular capsule different from the blood? Help please?
    9·1 answer
  • Which best describes why the cell membrane is selectively permeable?
    7·1 answer
  • How does the dna repair enzyme photolyase prevent skin cancer?
    11·1 answer
  • The Great Electron Chase: Describe the flow of electrons from rain falling on your strawberry garden into the strawberry plant (
    11·1 answer
  • How are decomposers they took from the ecoystsem
    5·1 answer
  • What are the four factors demographers look at to determine population size
    8·1 answer
  • What kind of interaction do you think the prairie dogs have with the rattlesnakes?
    9·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Animals living together in a group for generations are called what
    13·1 answer
  • Help pls i will mark brainiest​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!