1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
3 years ago
14

Which term is used to describe marks on a drum or a photocopier?

Biology
2 answers:
xxMikexx [17]3 years ago
7 0
Watermarks is the correct answer
vovangra [49]3 years ago
7 0

Answer: Trash marks

Explanation:

The identification of the machine either photocopier or drum can be made by observing the defects over the copies generated through the machine. These defects are called as trash marks. These trash marks are because of the dust and dirt particles present inside the machine. They may also appear as a result of defect in the machine parts.

These particles can be seen as dark specks on the copy. If the suspect and the sample photocopied document have the same trash marks then this can be said that they have been generated from the same machine. The size, color, shape and groupings of these markings can be compared and matched to establish the link between the two or more comparable documents.

You might be interested in
Most of the energy that your brain uses comes from
evablogger [386]

Answer:

Glucose

Explanation:

The brain is an energy-hungry organ. Despite comprising only 2 percent of the body’s weight, the brain gobbles up more than 20 percent of daily energy intake. Because the brain demands such high amounts of energy, the foods we consume greatly affect brain function, including everything from learning and memory to emotions.

Just like other cells in the body, brain cells use a form of sugar called glucose to fuel cellular activities. This energy comes from the foods we consume daily and is regularly delivered to brain cells (called neurons) through the blood.  

Studies suggest the quality of the foods consumed over a lifetime affects the structure and function of the brain. For instance, the consumption of omega-3 fatty acids found in fish provides structural material to maintain neurons. Studies also suggest omega-3 fatty acids are essential for the transmission of information between brain cells. In contrast, foods that are rich in sugars and saturated fats have been found to promote oxidative stress, which leads to damage to cell membranes.  

The food you eat also affects molecules in the brain that support cognition. Some foods, such as those with turmeric, support cognition by helping to maintain molecular events related to energy metabolism.

Recent studies suggest lifestyle choices that affect the metabolism of nerve cells, such as diet and exercise, may in some cases provide a non-invasive and effective strategy to counteract neurological and cognitive disorders.

6 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which characteristics describe this rock sample? Check all that apply. large crystals coarse texture evidence of rapid cooling f
Lena [83]

Answer:

a, b, e

Explanation:

You just have to pay attention to what you see

3 0
3 years ago
Read 2 more answers
When roan cattle are crossed, 25% of the offspring produced will have white coats, 50% will have roan coats, and 25% will have r
larisa [96]

Answer:

The results indicate that parentals were heterozygous for coat color and that the trait is inherited by incomplete dominance.

Explanation:

<em>Note: Due to technical problems, you will find the explanation in the attached files.</em>

<u></u>

     

Download pdf
5 0
3 years ago
Feral cats kill large numbers of native wildlife in Australia. Which technology would allow environmental scientists to know the
denis23 [38]
The correct answer is A.
In order to keep track of the feral cats' location, the animals should have a GPS tag that can be monitored. After the animal has been tagged and released, the scientists can track the movement of the animal and know its exact location at all times.
8 0
3 years ago
Other questions:
  • The human body uses the breakdown of macronutrients to obtain energy. the nutrients must be converted to (1)___________, which i
    15·1 answer
  • What is the full meaning of dna
    11·2 answers
  • Smog is the result due to the emissions of
    6·1 answer
  • Who have ideas about the biology class what is about ,and what you going to do in this class??
    14·1 answer
  • PLEASE HELP
    10·1 answer
  • Please answer the question under
    10·2 answers
  • Mike is measuring sound waves as they travel through different materials. Which of the following will Mike find to be true about
    10·1 answer
  • Which are reactants of photosynthesis?
    14·1 answer
  • HELP PLEASE THIS IS DUE TODAY.<br> BIOLOGY
    9·1 answer
  • Which of the following contain organs?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!