1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
14

Do you consider scientific truth as objective and universal? Explain your answer.

Biology
1 answer:
Irina18 [472]3 years ago
5 0

Explanation:

Tahukah kamu, mengapa motor berhenti di depan lampu merah?

karena motornya direm. Coba kalau nggak direm bisa bahaya tuh.

Tebak binatang apa yang jago renang?

Bebek. Kalau ikan bukan renang tapi menyelam

Kenapa di rel kereta api ditaruh batu?

Soalnya kalau ditaruh duit nanti pada diambil.

You might be interested in
How is the sun affecting the dead sea​
ch4aika [34]

Answer:

In the Dead Sea, they found that the rate of evaporation peaks during the day just a few hours after solar radiation peaks.

6 0
3 years ago
What is the best description of chromosomes by the end of metaphase II of meiosis
kotykmax [81]
Lines up in the middle of the cell
5 0
3 years ago
Read 2 more answers
Which statement describes an important role of carbon dioxide in Earth's atmosphere?
MrRissso [65]

Answer:Plants use carbon dioxide to make food

Explanation: Carbon-dioxide plays a very important role in sustaining life on Earth.

Plants use carbon-dioxide and water for photosynthesis in presence of sunlight and chlorophyll to produce food and oxygen.

CO₂ + H₂O →  O₂ + glucose (food)

This food is consumed by the animals and oxygen is used for respiration. Animals use energy from the food to do work and exhale back carbon-dioxide.

5 0
3 years ago
Read 2 more answers
He beginnings of a brain first becomes apparent around four weeks after conception when the neural ____ folds to form the neural
Tresset [83]
The beginnings of a brain first become apparent around four weeks after conception when the neural plate folds to form the neural tube
5 0
3 years ago
Read 2 more answers
What are the special features of a sperm cell
Airida [17]
<span>Long tail for swimming
<span>Head for getting into the female cell

Hope this helps you ! :') </span></span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • How does driving in a car that uses gasoline connect to the carbon cycle
    14·1 answer
  • Compare and contrast the human and cat mouth and throat structures
    8·2 answers
  • Which phase of mitosis is the cell most likely in when a cell is found to have two nuclear envelopes and spindles that appear to
    5·1 answer
  • Which of the following is true? Group of answer choices In the brain, neurons are more abundant than neuroglia. An action potent
    6·1 answer
  • How do our social groups and social interactions impact our behavior?
    6·2 answers
  • a heavily populated town with a housing shortage is located near one large river the water in the river is not heavily polluted
    5·1 answer
  • Punnett squares can be used to predict the probability of...
    5·1 answer
  • The energy that a plant needs to grow is
    11·1 answer
  • The Corpus Callosum does what? *
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!