1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
3 years ago
7

The normal post-void residual urine in the bladder is a. none of these; no normal residual volume is identified. b. less than 10

0 mL. c. 150 to 200 mL. d. 250 to 300 mL.
Biology
1 answer:
natta225 [31]3 years ago
5 0

Answer:

B.

Explanation:

The postvoid residual volume less than 50 mL is considered normal, and the volumes greater than 100 mL is generally considered abnormal

You might be interested in
Which of the following is a decomposer? A. Grasshopper B. Sunlight C. Tadpole or D. Earthworm
romanna [79]

Earthworms are decomposers



5 0
3 years ago
Read 2 more answers
Help pwessssssssssss​
Alecsey [184]

Answer:

It is Eris, a dwarf planet to but a bit bigger than Pluto, so the answer is D

Explanation:

8 0
3 years ago
Read 2 more answers
Which sentences in this excerpt from Ernest Hemingway's "In Another Country" show that medals and awards in war don’t always bri
s2008m [1.1K]

The options attached to the above question are given below:

A) The boys at first were very polite about my medals and asked me what I had done to get them.

B) I showed them the papers which were written in very beautiful language of full of fratellanza and abnegazione but which really said with the adjectives removed that I had been given the medals because I was an American.

C) after that their manner change a little toward me although I was their friend against Outsiders

D) I was afraid but I was never really one of them after they had read the citation because it had been different with them and they had done very different things to get their medals.

E) I had been wounded it was true but we all knew being wounded after all was really an accident.

ANSWER

The correct option is D.

In the statement given in option D, it can be seen that the speaker was formerly a soldier, who had fought in a war and had been awarded a medal to that effect. But despite knowing about this meritorious service that he had rendered to his country and the award he was given, he was not really accepted as an inner person by the group of people that was refereed to in the statement. They did not think much of him.


5 0
4 years ago
Read 2 more answers
Water would be considered a ________.
Mamont248 [21]

Answer:

<em>Water would be considered a </em><u><em>actual renewable resource</em></u><em>.</em>

C. Actual renewable resource

3 0
3 years ago
Read 2 more answers
for which of the following processes are enzymes not required? multiple choice replication self-assembly translation maturation
saveliy_v [14]

The process of assembling individual units of a material into highly arranged/ordered structures/patterns is known as self-assembly. Self-assembly processes are enzymes not required.

Self-assembly is the process by which a disordered system of pre-existing components forms an organized structure or pattern as a result of specific, local interactions among the components themselves, without the need for external direction. When the constituents are molecules, the process is known as molecular self-assembly.

What are the types of self-assembly?

Self-assembly is classified into two types: intramolecular self-assembly and intermolecular self-assembly. The term molecular self-assembly most commonly refers to intermolecular self-assembly, whereas folding refers to the intramolecular analog.

Learn more about self-assembly to visit this link

brainly.com/question/13957452

#SPJ4

3 0
1 year ago
Other questions:
  • The correct sequence of sound waves in the ear is ________.
    14·1 answer
  • Squirrels and chipmunks compete for the same food source. What is most likely to happen to the degree of competition between the
    15·2 answers
  • James is making models of plant and animal cells using objects supplied by his teacher to represent organelles. For one cell, he
    14·1 answer
  • You have two substances. Alcohol: density 0.8 g/ml and Glycerin: density
    7·1 answer
  • Grandpa Sam used to tell his grandkids how he first laid eyes on Grandma Sylvia. “When I was courting your granny, I was dazzled
    14·1 answer
  • Which of the following is a characteristic of protein synthesis in prokaryotes?
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • WILL IVE BRAIN?? Why might humans not have widespread regeneration abilities?
    9·1 answer
  • In Mendel's pea plants, green and round peas are dominant to yellow and wrinkled peas. If Mendel
    9·1 answer
  • Im doing an experiment with Brine shrimp and I am confused how to set up the experiment and the data table. The experiment is to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!