atpase pump can also be called atp synthase. this enzyme catalyses atp formation from adenosine diphosphate and phosphate. it has f1, stalk and f0 components. 3 positive hydrogen ions go through to make 1 adenosine triphosphate molecule. oxidative phosphorylation has to do with the loss of electrons. there would be electrons loss from NADH to FADH2. Cytochromes carries them through different series of transferases from I to IV and while on this positive hydrogen ions are released into mitochondrial matrix

positive hydrogen ions are moved back to lumen through adenosine triphosphate channels. a process called chemiosmosis. the pro

5 0

2 years ago

Read 2 more answers

What base is found in dna and not in rna

vagabundo [1.1K]

Answer:

uracil

Explanation:

3 0

2 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Why do people buy water after eating pretzels?

Ede4ka [16]

Salt on the pretzel causes thirst idk tbh

3 0

3 years ago

Read 2 more answers