1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
11

Question 10(Multiple Choice Worth 2 points)

Biology
1 answer:
torisob [31]3 years ago
4 0
Arteries are used to carry oxygenated blood away from the heart to the tissues & body. Capillaries are very tiny blood vessels that form a network with the tissue to exchange blood and nutrients. They work work with the arteries.
You might be interested in
describe a situation in nature where genetic drift might be a more important influence on evolution than natural selection.
inna [77]

Answer:

Example of genetic drift

Explanation:

a population of rabbits with alleles B and b, both alleles are present in equal frequencies p = 0.5 and q = 0.5 if 10 parents reproduce the probability of having an offspring with alleles B or b is 0.5; however, by chance, a slight difference in the offspring allele frequency might occur due ...

4 0
2 years ago
How have crops been modified?
frez [133]

Answer:

Plants have been made more susceptible to pests for modification.

8 0
3 years ago
What is the best characterization of a fine grained igneous rock?.
Ede4ka [16]
It’s cranky and white shaped where it’s pretty shiny and crystals inside them where they spark off your eyes
8 0
2 years ago
Jane had leukemia as a child and had to undergo numerous bouts of chemotherapy. The chemotherapy always made her nauseous. As sh
Stels [109]

Answer:

The waiting room became the conditioned stimulus.

Explanation:

Conditioned stimulus is the reflexive behaviors or the learned behavior.

This stimulus may be defined as a neutral stimulus that with some time and some training will evoke a response by continuously being associated with any other natural occurring stimulus.

4 0
3 years ago
Which of the following is a kingdom classification? A. plants B. protists C. animals D. All of the Above
faust18 [17]
D.it is d im sure bcz they seem to be correct
4 0
3 years ago
Read 2 more answers
Other questions:
  • If you need to prevent waves from eroding a beach, what would you do
    9·2 answers
  • Plants make energy. Some of it they use to perform the necessary functions of living. What do they do with any excess energy?
    6·1 answer
  • Which of the following infectious agent is unicellular?
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • During a discussion about ecosystems, a student says, "Plants eat sunlight, and animals eat other organisms." Which of the follo
    15·1 answer
  • Hopefully this is it but whats the andwer to this-
    14·2 answers
  • In a study on the biological bases of learning, lab rat a is given a drug that blocks dopamine activity in its brain. thereafter
    8·1 answer
  • This fossil trilobite and this living blue crab both have a limb structure called a biramous limb. What best explains why both s
    10·1 answer
  • What is the natural source of energy in Mars, please help
    15·2 answers
  • True or false: autosomes are sex chromosomes
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!