1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
14

Who have ideas about the biology class what is about ,and what you going to do in this class??

Biology
1 answer:
sveta [45]3 years ago
8 0

Answer: about biology

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
(WILL GIVE BRAINLIEST AND THANKS) As an airplane rises through the atmosphere, machines cause the pressure inside the cabin to d
UNO [17]
These changes are necessary because of gravity 
6 0
3 years ago
Read 2 more answers
Because a heavy saturation of water greatly increases the weight of soils, the force of friction is more likely to pull the
choli [55]
The correct answer is True.
4 0
3 years ago
Read 2 more answers
Fill the blanks plz
o-na [289]
The answer is to do what you must my friend, goodluck!!

#1
Inner stem cell mass


#2
Harvested Unspecialized Embryonic Stem Cells
7 0
3 years ago
Read 2 more answers
2.How are the amino acids formed from the codon in Mutation #2 different from those formed from the original codon pattern.
DENIUS [597]

Mutations are caused by changes in nucleotide bases. these altered base formed different amino acid depending upon nucleotide base sequence that code specific amino acid. ... even though some mutations, can have a more effect on amino acid coding, which can affect what kind of proteins are produced.

8 0
2 years ago
Other questions:
  • below is a table of organisms information on their characteristics. based on the information in the table which organism is like
    6·1 answer
  • Which of the following is a value of biodiversity?
    14·2 answers
  • g The ultimate significance of the fact that artificial selection often leads to change in the tested population is that it a. s
    7·1 answer
  • She planned to observe the flowers for the next five days for an hour at the same time each afternoon. Then she would plot the d
    9·2 answers
  • A multiparous client thought to be at 14 weeks' gestation based on uterine size has such severe morning sickness that she has "n
    15·1 answer
  • In rabbits, short hair (S) is dominant over long hair (s). What genotype and phenotype ratios are
    6·1 answer
  • Describe the steps of the rock cycle and relate them to weathering, erosion, plate tectonics, and mountain building
    6·1 answer
  • What was George H. W. Bush’s “new world order?
    12·1 answer
  • Explain 2 social benefits of biodiversity
    10·1 answer
  • What are the building blocks of proteins
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!