1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
2 years ago
8

SOMEONE PLEASE HELP ME WITH THIS ILL GIVE YOU BRAINLY IF YOU GET IT RIGHT ALSO EXPLAIN HOW YOU GOT THE ANSWER!!!!

Biology
1 answer:
LiRa [457]2 years ago
3 0

Answer:

I would say A, as both were considered more of cultures.

The Tao were influenced by Buddhism, not the other way around.

karma isnt really a main factor in Shintoism, but it does play a large role in Buddhism.

Both Buddhism and Shintoism do not share the idealistics of abraham

Explanation:

- Eijiro <3

You might be interested in
What is an surfactant?
Sedbober [7]
A substance that tends to reduce the surface tension of a liquid in which it is dissolved (took that right from dictionary.com)
3 0
3 years ago
Which of the following best describes the purpose of examining mammary secretions in mares before parturition?
Arisa [49]

The statement that best describes he purpose of examining mammary secretions in mares before parturition is testing for elevated levels of calcium.

<h3>What is the processes of parturition in mares?</h3>

In parturition, a fetus is fully developed, a process called Ferguson reflex occurs to stimulate contractions. The canal is lubricated by a fluid called allanotic fluid and facilitates the discharge of the amnion and the fetus. A virginal distension releases oxytocin and more contractions.

For a mare to be ready for parturition, elevated levels of calcium is tested from the mammary gland to confirm that the mare is healthy and ready for parturition.

Learn more on parturition here: brainly.com/question/14982881

#SPJ1

3 0
1 year ago
Why are some diseases more common in certain groups of people, such as caucasians or African Americans
Anna71 [15]

Answer:

Some diseases are more common in certain groups of people, such as Caucasians or African Americans because individuals in such ethnic groups often share certain alleles (versions of their genes), that have been passed down to them from common ancestors and a particular genetic disorder may be more frequently seen in such groups if one of these shared genes contains a disease-causing mutation.

Explanation:

Some genetic diseases are frequently seen in certain ethnic groups like Caucasians or African Americans. Individuals in such groups often share certain alleles (versions of their genes), that have been passed down to them from common ancestors and one of these shared genes may contains a disease-causing mutation.

Examples of certain genetic disorders that are more common in particular ethnic groups include the Tay-Sachs disease, which is more common in people of eastern and central Europe (Ashkenazi), Jewish or French Canadian ancestry and the sickle cell disease, which occur among people of African, African American, or Mediterranean heritage.

Some genetic disorders are more common in people whose ancestry can be traced to a particular geographic area. The factors that can lead to development of populations with very different genetic allele frequencies include their geographic origin, selection, patterns of migration, historic events, etc. Certain natural barriers like oceans and other water bodies, high mountains, large deserts, or major cultural factors had prevented communication and interaction between people. So mating was restricted within the group, and this produces genetic marker differences and differences in the presence of specific disease-related alleles.

6 0
2 years ago
There are several external forces that acct on rocks in the rock cycle. Which one is
zhenek [66]
The answer is B. pressure
4 0
3 years ago
Read 2 more answers
What is the arrangement of the color in the visible light spectrum from low frequency to hig
atroni [7]

Answer:

D. Red, Orange, Yellow, Green, Blue, Indago, Violet.

Explanation:

Violet has the highest freqency and red has the lowest.

Hope this helped!

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is the best description of translation?
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The experiment that produces the most reliable results is the one in which the
    13·2 answers
  • Color blindness is a recessive sex linked disorder in which the proteins that absorbs red and green light in the eye do not work
    5·1 answer
  • How is 120,700 written in scientific notation
    14·1 answer
  • Oogenesis occurs in the -----<br><br> Spermatogenesis occurs in the ------?
    9·2 answers
  • Natural disasters can also play a huge role in changing selection pressures for a species. How could a natural disaster cause a
    15·1 answer
  • The point on earths surface where the earthquakes energy first occurs is the
    10·1 answer
  • Molten lava come to the surface and cool forming the first land. true or false
    15·2 answers
  • Question 7 (True False Worth 1 points) (01.02 LC) The results of an experiment can be validated through replication O True 0 Fal
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!