1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
3 years ago
11

How is a scientific law different from a scientific theory?

Biology
2 answers:
Tomtit [17]3 years ago
7 0

Your answer is option c.

We know a theory is not just for biology and chemistry since we have the theory of relativity

We also know that both theories and laws can be disproved or changed.

And a theory does not become a law after a long time period

thus the answer is C

irina [24]3 years ago
6 0

Answer:

The correct answer will be option-C.

Explanation:

Scientific theories and scientific laws are proposed after many hypothesis related to the natural phenomenon is supported by experiments of many researchers.

Both scientific laws and scientific theory are the statements formed on the basis of the results but they differ as a scientific law represents the mechanism of how natural phenomenon is as it provides the data related to the natural event which hold true everywhere whereas a scientific theory provides the explanation of the causes of a natural event.

Thus, option-c is the correct answer.

You might be interested in
Do eggs in apple protect and nourish the Embryo
Arisa [49]

An egg developes to a new into a new animal after its fertilized by the male reproductive cell or sperm. No matter how an animal reproduces its eggs it must provide ways or nourishing and protecting the developing embryo. Have a great day hope this helps you :)

4 0
3 years ago
Teresa was told by her doctor that her unborn baby has XY chromosomes. What does this
xz_007 [3.2K]

Answer:

The baby is a male. XY = male, XX = female.

Explanation:

Hope this helps.

7 0
3 years ago
Almost all enzymes are what class of organic molecule?
Leno4ka [110]
Enzymes are in the Proteins class
7 0
3 years ago
Order the carbohydrates from smallest to largest: Starch Glucose Sucrose
nydimaria [60]

Answer:

glucose, sucrose, starch

3 0
3 years ago
Why do we get a stitch when we run?
babunello [35]
It helps your body be more flexible and prepared to run.
5 0
4 years ago
Other questions:
  • Which of the following statements accurately describes melanin’s function
    14·1 answer
  • Which selection correctly describes the role of calcium in coupling?
    10·1 answer
  • Explain four treatment options for hazardous waste.
    9·1 answer
  • Hippopotamuses live in Africa’s rivers and lakes. They’re herbivores and coexist with other herbivores and carnivores. Which act
    11·2 answers
  • 62 Which law of motion accounts for the following statement? "When a marble
    6·2 answers
  • Suppose a sound wave with a frequency of 444 Hz combined with a sound wave with a frequency of 436 Hz. How many beats would you
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following chemicals creates acid rain?
    14·1 answer
  • summarize the carbon cycle and hypothesize how the combustion of fossil fuels affects the amount of carbon dioxide in the ocean
    6·1 answer
  • How long does it take to get a replacement naturalization certificate.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!