1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nina [5.8K]
4 years ago
9

Question 5 of 10

Biology
2 answers:
Tcecarenko [31]4 years ago
4 0

Answer:

B. Replanting trees in deforested areas.

erastova [34]4 years ago
4 0

Answer:

The activity that would effectivly keep the oxygen cycle stable would be replanting treesin a deforest area, because now not only are you recreating that area for organisms to live in again, but creating more oxygen.

A. Dumping waste wouldn't help resolve anything, because now you are ruining not only the environment but the water supply, and the aquatic organisms.

C. Raising more cows on farm, wouldn't really resolve anything much.

D. Pruining trees would basically be cutting them, which wouldn't help with oxygen levels, moreover, you are decreasing it.

You might be interested in
List and explain the 4 different types of variables and explain them.
vagabundo [1.1K]

Answer:

independent, dependent, control

Explanation:

The independent variable is the variable that you change. For example, if we were growing plants and wanted to see if more sun made them grow higher, you would change the amount of sun that each plant is exposed to.

The dependent variable is what you measure. This <em>depends</em> on the independent variable. So, in our plant experiment, the height of the plant is the dependent variable.

Control. The control is what stays the same. So in our plant experiment, the amount of water, type of plant, type of soil, and all of these things would stay the same to insure that the results are equal.

8 0
4 years ago
Read 2 more answers
Which type of environmental scientist is most likely to study how whales are affected by pollution?
ella [17]
<span>An oceanographer would be most likely to study how whales are affected by pollution. An Oceanographer is a scientist that studies all aspects,physical and biological that pertain to the ocean. The topic of whales and pollution can fit under the study of ocean ecosystem dynamics which falls under the large umbrella of oceanography.</span>
4 0
3 years ago
Read 2 more answers
Equal masses of steel wool are placed in four beakers. Equal amounts hydrochloric acid (HCI) are added to three beakers in the f
Oksi-84 [34.3K]

Answer: the steel wool in the 3.0 M HCl reacts fastest.

Explanation:

3 0
3 years ago
Please help i dont undrstand
yulyashka [42]

Answer:

The number of primary consumers will increase

Explanation:

If all the secondary consumers disappear, the primary consumers will continue to reproduce causing the population to increase

4 0
3 years ago
Read 2 more answers
Energy can change from one form to another.<br> True or False
NeTakaya

TRue

Explanation:

first law of thermodynamics energy can be changed from one from to another

7 0
2 years ago
Other questions:
  • Choose the four types of food molecules digested by the intestines. vegetables,sugars,starches,meats,fats,or proteins. multiple
    8·1 answer
  • The ____________ contains mitotic cells. the ____________ contains layers of compacted, highly keratinized epithelial cells. the
    5·2 answers
  • Part A - Access and view the Louisiana Wetlands Loss: Coastal Erosion animation produced by New Orleans Times Picayune. Describe
    6·1 answer
  • What do scientists hope to accomplish using recombinant DNA?
    11·1 answer
  • Where can you get your outdoor annual and how much does it cost?
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Major organs form and cells continue to divide in the __________ stage. A. embryo B. fetus C. blastocyst D. zygote
    12·2 answers
  • HEY!!! PLEASE HELP ME I WILL GIVE BRAINLEST!!!
    7·1 answer
  • Nucleic acids are composed of:
    14·1 answer
  • A human red blood cell in an artery of the left arm is on its way to deliver oxygen to a cell in the thumb. To travel from the a
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!