1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ronch [10]
3 years ago
6

True or false, if false, write the correct answer. Plant leaves appear green because chlorophyll "absorbs" green like​

Biology
1 answer:
alukav5142 [94]3 years ago
6 0

Answer:

No, the statement is false.

Explanation:

Light is made up of many colors. When light rays incident on the surface of any object so the surface absorb all the colors except of that color which is present in the object. Plant leaves having green color due to the presence of chlorophyll. When light rays incident on leave surface, leave absorb all colors and reflect only green colour. That's why we see the green color of the plants.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What percentage of Earth’s surface is covered by water?
neonofarm [45]

Answer:

71 %

Explanation:

6 0
3 years ago
Read 2 more answers
What determines how an atom bonds with other atoms?
Hitman42 [59]
The number of each electron in its shell determines how an atom combines with other atoms to form compounds.
6 0
3 years ago
Read 2 more answers
What is the function of cholesterol molecules in a cell membrane
Alborosie
Cholesterol Molecules acts as a "super glue" between the lipids in the cell membrane, whilst allowing it to remain flexible. 
8 0
3 years ago
If cyanobacteria never evolved during earth's history, how would their absence affect the composition of earth's atmosphere?
Blababa [14]
Cyanobacteria, also known as blue-green algae, are found in vast quantities in fresh and salt water. Cyanobacteria are able to conduct photosynthesis. By utilising energy from the sun, they produce carbohydrates from water and carbon dioxide. As a byproduct, they produce oxygen. So cyanobacteria provided oxygen to the atmosphere that allowed other lifeforms to develop.
3 0
3 years ago
Other questions:
  • Where are stem cells harvested from? Name 2 places.
    14·1 answer
  • How did agre use simple osmosis experiment to prove the function of aquaporin?
    9·1 answer
  • Why do all cells need cytoplasm?
    14·1 answer
  • What are the two most important processes in the cycling of oxygen in and out of the atmosphere
    13·1 answer
  • What is a traditional Chinese touch therapy involving finger pressure applied to specific areas of the body to restore the flow
    9·2 answers
  • A scientist would like to test the effect of heat on the function of a certain enzyme. Which would not be an appropriate first s
    10·1 answer
  • What happen to a raw chicken bone being put in a vinegar?
    14·1 answer
  • Starch is a polysaccharide that contains...
    9·1 answer
  • Biology Pretest: evolution
    12·1 answer
  • Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!