3 years ago

Which is the definition of taxonomy

1 answer:

7 0

Taxonomy is the branch of science that concerns labeling and classifying living things into more manageable groups. This helps scientists better understand certain species and their connections to other species.

You might be interested in

Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG

trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0

2 years ago

How does crossing over affect the genes being passed on to the offspring??

Lina20 [59]

Crossing over, or recombination is the exchange of chromosome segments between non sister chromatids in meiosis. Crossing over creates new combinations of genes in the gametes that are not found in either parent, contributing to genetic diversity.

5 0

2 years ago

In addition, as organisms grow and change, they need new cells to make more skin tissue, bone tissue, muscle tissue. These new c

vazorg [7]

What’s the question?

6 0

3 years ago

two important steps involved in genetic engineering are cutting the desired gene from its genome, then cutting the vector genome

Shkiper50 [21]

Enzymes working on the DNA strand?

6 0

2 years ago

g four pairs of species are given, with descriptions of how they interact. Match each system of differential equations with a sp

7nadin3 [17]

Answer:

Explanation:

4 0

3 years ago