1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
3 years ago
14

Why are enzymes important for a healthy body?

Biology
1 answer:
Aleksandr-060686 [28]3 years ago
6 0

Answer:

Enzymes are involved in the formation and composition of every cell in the body. Thus they also control the working of every organ and even the brain - the control center. They are involved in the breakdown, absorption, distribution and circulation of various nutrients entering the body.

Explanation:

You might be interested in
During fertilization, a __________ and __________ combine to form a __________.
sineoko [7]
During fertilization, a _sperm_ and _egg_ combine to form a _zygote_.

Sperm and egg (gametes) are both haploid, and the fertilized zygote is diploid.
6 0
3 years ago
Where is the foramen magnum found
Ksivusya [100]
Upper surface of base of the skull
3 0
2 years ago
Cell respiration begins with
irinina [24]

Answer:

Cell respiration begins with Glycolysis .

Explanation:

Glycolysis  is the first and initial step in the cellular respiration. Cellular respiration is the anaerobic process, which takes place in cytosol of the cells. Two molecule of pyruvate(CH3COCOO-) are formed from 1 molecule  of  glucose(C6H12O6)through glycolysis. The  NADH and  ATP are high energy molecules formed when the free energy are released. It is the process which takes place through a series of ten enzyme catalysed reactions. 10 enzymes are required to break down the sugar molecule. It occurs in cytoplasm.

8 0
2 years ago
What is an autosomal disorder ​
katrin2010 [14]

Answer:

Explanation:

Autosomal recessive is one of several ways that a trait, disorder, or disease can be passed down through families. An autosomal recessive disorder means two copies of an abnormal gene must be present in order for the disease or trait to develop

8 0
2 years ago
Read 2 more answers
Where do new cells come from? <br>other cells<br>nucleus<br>macrophages<br>Golgi body​
zavuch27 [327]

Answer:

Other cells.

Explanation:

All cells come from other cells as cells are "produced" when a cell divides into two.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Comparatively greater energy is released when A. carbon dioxide is the final electron acceptor.B. hydrogen is the final electron
    6·1 answer
  • What is the proper term for the fires set<br> within the Amazon?
    14·1 answer
  • In humans, the feet could be considered both ____________ and ____________ structures.
    7·2 answers
  • -what new inventions made possible for scientists to practice direct observation?
    13·1 answer
  • ANSWER THE QUESTIONS RIGHT AND YOU WILL GET 50 POINTSSS!!!!!!!!!
    9·1 answer
  • Which situation can cause positive population growth?
    8·1 answer
  • The volume of a right circular cylinder can be approximated as follows: Volume = ?r2h; where r is the radius of the cylinder and
    14·1 answer
  • What is Newton's third law of motion
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Some plant seeds germinate better if scarified in the stomach of a bird or being singed in a forest fire.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!