1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka21 [38]
3 years ago
8

Predict my happen to population that is experiencing little immigration and emigration low birth rate and high death rate

Biology
2 answers:
Furkat [3]3 years ago
7 0
The population would decrease because the high death rate and low other rates would lead to more deaths than births, and not many other people would be entering the country/place, so the population would decrease
Volgvan3 years ago
7 0

Answer:

A

Explanation:

You might be interested in
The SWAG scientist wrote this description (in the picture below) of a cell after looking at it under the microscope. Which type
LenaWriter [7]

Answer:

I think bacterial cell becausea microscope look into small organisms that we can't see with a naked eye

3 0
3 years ago
True or false: it is necessary to have a nervous system to sense and respond to the environment.
Mila [183]
Hello!

This would be false as it is just nerves inside of the body impulsing between each other and that would not be necessary to adapt to a new environment. 

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy
5 0
3 years ago
What is a solstice?
nevsk [136]

Answer:

4 or D

Hope it’s right ;)

5 0
2 years ago
Read 2 more answers
• Which category of energy interested you the most? Choose from one of the following: fossil fuels, nuclear energy, biomass, hyd
grandymaker [24]

Answer:

geothermal energy

Explanation:

7 0
3 years ago
Read 2 more answers
Women capable of becoming pregnant are often deficient in which vitamin? folate vitamin b6 vitamin c vitamin d
VARVARA [1.3K]
That would be "folate"
4 0
3 years ago
Other questions:
  • The powerhouse of the cell: that is a term used to describe the ______________, because it's main function is to produce energy
    15·1 answer
  • Which sense is not affected by damage to the thalamus?
    8·1 answer
  • 1. What is a macromolecule? Name four macromolecules present in all living things and identify what they have in common.
    5·1 answer
  • Is a term which describes a membrane that allows only certain molecules to pass through it?
    14·1 answer
  • An x-ray technique imaging the urinary bladder and ureters is:
    8·2 answers
  • En un cruzamiento entre plantas de guisante homocigoto con semillas amarillas redondas (YYRR) y plantas de guisantes homocigoto
    8·1 answer
  • List TWO of the ethical guidelines regarding professional courtesy among forensic scientists
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Is cellular respiration an endothermic or exothermic reaction
    7·1 answer
  • When you place your hand near a candle flame your hand will get warm due to
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!