1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KATRIN_1 [288]
3 years ago
11

Drag each description to the correct location on the image. Not all descriptions will be used.

Biology
1 answer:
amm18123 years ago
6 0

Answer:  Layers of the Sun are : Core, Radiative zone and convection zone

(all three constitutes inner layers), photosphere, chromosphere, transition region and corona (all four constitutes outer layer).

Explanation:

The Sun is made from hydrogen and helium.

The Sun is consists of inner and outer layer. Inner layer constitutes main part of the Sun and is further classified into 3 parts -  Core, Radiative zone and convection zone .

The atmosphere of Sun forms it's outer layer which comprises 4 parts - photosphere, chromosphere, transition region and corona.

Light and heat radiated from Sun is energy that is released from Sun as part of nuclear reaction that takes part in it's middle part know as core.

Energy from core moves as electromagnetic radiation towards radiative zone, from where is moves out further by photon carriers.

From radiative zone energy moves towards convection zone. This zone is the outer most of zone of Sun's inner layer and it is here where light energy coming from core layer is converted into light form.

You might be interested in
Why is nitrogen fixation such an important step in the nitrogen cycle?
Vikki [24]
The Answer to question number two is the sun
6 0
4 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
How are respiratory illnesses primarily spread?
ipn [44]

Answer:

coughing and sneezing

4 0
3 years ago
Read 2 more answers
Is a group of species that includes an ancestral species and all of its descendants?
Alekssandra [29.7K]
A clade is a group of species that includes an ancestral species and all of its descendents
5 0
3 years ago
I forgot what an independant variable is please explain
Darya [45]
An independent variable is something a Scientist messes with like baking soda and vinegar the independent variable is the baking soda and vinegar and the dependant variable is the explosion
7 0
3 years ago
Read 2 more answers
Other questions:
  • The restriction enzymes that cut the bacteriophage DNA cannot cut the bacterial chromosomal DNA. Explain this statement. A. The
    12·1 answer
  • BRAINLIESTTT ASAP!! PLEASE HELP ME :)
    6·1 answer
  • Which statement about vacuoles is true
    14·1 answer
  • Deduce how two genes for different traits that are on the same chromosome can fail to be inherited together.
    10·1 answer
  • Help ASAP!!
    11·1 answer
  • {10points} What did people invented using anatomy of frog?
    5·1 answer
  • The heavier the object the _____________________ _____________________ it has if it has the same velocity at all masses.
    10·1 answer
  • A mutagen is
    14·1 answer
  • Why did Mendel study pea plants?
    12·2 answers
  • A.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!