3 years ago

Two students were having a discussion about viruses.

Biology

2 answers:

BaLLatris [955]3 years ago

8 0

Answer:

student A (f)

Explanation:

iren [92.7K]3 years ago

3 0

Student A who believes viruses are non living organisms.

Explanation- Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy.

You might be interested in

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

3 years ago

Predict what would happen to the H+ ion concentration if you added sulfuric acid to water. Would the pH increase or decrease

alexira [117]

You would add H+ ions if you added an acid. Thus lowering the pH.

8 0

3 years ago

Which of the following best describes why scientists often study embryonic structures when determining evolutionary relationship

zhannawk [14.2K]

There are sometimes similarities in the embryonic stages of organisms that do not exist in the adult stages.

5 0

3 years ago