1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
9

How do scientists study pollen grains to help them understand climate change ?​

Biology
2 answers:
Kipish [7]3 years ago
7 0

Answer: by analyzing and making inferences about them

by observing and listing facts about them

by studying and reading more about them

by inspecting them and sharing findings with other scientists

notka56 [123]3 years ago
5 0

Answer:

Its A

Explanation:

hope this helps!!

correct me if im wrong

You might be interested in
A founding population of lizards arrives on a island.Which type of isolation would likely result in this population becoming a n
Marina86 [1]
The answer is geographical isolation.
7 0
3 years ago
Read 2 more answers
I wonder if fish and marine mammals drink salty water
Valentin [98]

Fish and marine mammals sift out the salt from the water, then they drink it.
8 0
3 years ago
Read 2 more answers
Which action is an effect of lowered inhibitions? (Points : 1) doing or saying things out of line with one’s beliefs or values r
Genrish500 [490]
"Doing or saying things out of line with one’s beliefs or values" and "revisiting previously <span>pent-up emotions" are the most common effects of lowered inhibitions, especially when alcohol is involved. </span>
6 0
3 years ago
What are atoms made out of??
allochka39001 [22]
I think so it is molecules
3 0
3 years ago
Read 2 more answers
When developing a strength-training program, if you want to increase muscular strength, you need?
Free_Kalibri [48]

<span>When developing a strength-training program, and you want to increase muscular strength, you need to </span>eat a diet that promotes muscle strength. How? 1) Eat a lot of protein. 2) Get your calories from healthy sources and 3) Supplement your diet with m<span>any bodybuilders,  different muscle-building products like creatine supplements. </span>

7 0
3 years ago
Other questions:
  • Dialog control is the main function of the session layer. describe how dialog control works.
    5·1 answer
  • Cellular respiration occurs within the ________ of a cell.
    5·1 answer
  • Which of the following is a characteristic of RNA splicing in Eukaryotes?
    7·1 answer
  • Please HELP I will give 85 points and Brainliest. Develop a logical argument about whether to use CRISPR/Cas9 to edit the human
    5·1 answer
  • From the list below, choose the term that best completes each sentence and write it in the blank.
    12·1 answer
  • What four characteristics of an aquatic environment might make photosynthesis or life processes difficult for aquatic plants? Li
    7·1 answer
  • Why did land animals evolve back to aquatic environments?
    6·2 answers
  • What ignited the Cambrian explosion of life?
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 21. Which is a characteristic of aerobic respiration?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!