1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
9

A seed was discovered and, when planted, grew to be a large flowering plant. ​

Biology
1 answer:
Crazy boy [7]3 years ago
4 0

Answer:

The answer is Eukarya.

Explanation:

You might be interested in
Which is of the following is an organic molecule?
Kisachek [45]
The answer is A which is CH4.
5 0
3 years ago
What is the main source of carbon in an ecosystem?
sleet_krkn [62]

The main source of carbon dioxide in an ecosystem is the carbon dioxide gas present in the atmosphere. This carbon dioxide is used by the  plants and animals in different ways.

The plants use this carbon dioxide to perform the process of photosynthesis.This is carried out by the help of green pigment called chlorophyll that absorbs light from the sun, water from soil and carbon dioxide from atmosphere.

The carbon in animals comes when they eat these plants.

4 0
3 years ago
Which of the following is the correct order in a food chain?
Kamila [148]

Answer:

2/3 of the students in a class are girls. if there are 20 boys in the class. then the totoal number of girls isthe length of abhishek's notebook is 17cm and 8 mm. What will be its length in cma fraction has no2/3 of the students in a class are girls. if there are 20 boys in the class. then the totoal number of girls isthe length of abhishek's notebook is 17cm and 8 mm. What will be its length in cm

6 0
3 years ago
If 1000 f2 offspring are obtained, how many flies of each phenotype are expected?
aniked [119]
<span>In Drosophila + indicates wild-type allele for any gene, m is mahogany and e is ebony. Female parents are m+/m+ and males are +e/+e. F1 are m+/+e, all wild type. F1 females are crossed with me/me males - the test cross. Offspring will be : non recombinant m+/me, mahogany wild type or +e/me wild type ebony. OR recombinant me/me mahogany ebony or ++/++ wild type. As the two genes are 25 map units apart, the percentage of recombinants will be 25% and therefore percentage parental types will be 75%. 75% 1000 is 750. There are two parental types, so you would expect 375 of each. Therefore, you would expect 375 m+/me and 375 +e/me. 25% of 1000 is 250 split between two recombinants =125 of each. Therefore you would expect 135 me/me and 125 ++/++</span>
7 0
4 years ago
Where is the youngest rock in the Atlantic Ocean found? <br><br> plz hurry
Zielflug [23.3K]

Answer:

Mid-Atlantic Ridge

Explanation:

This is because they are deep down, near the earth's crust .

3 0
3 years ago
Other questions:
  • What is the smallest part of a cell?
    13·1 answer
  • Which of the following are the correct name and function of structure A? A. nucleolus; ribosome assembly B. mitochondrion; conve
    11·2 answers
  • How will the student need to revise the model to demonstrate a prokaryotic cell rather than a eukaryotic cell?
    9·1 answer
  • the pupil opens and closes automatically in response to light what part of your nervous system controls this response
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In 1668, Francesco Redi conducted an experiment with jars of meat. This experiment was noteworthy because it
    15·1 answer
  • Which of the following is an example of liverwort
    5·1 answer
  • Cómo comienza a formarse la materia más sencilla en el comienzo del big bag?
    14·2 answers
  • Where would deposition most likely occur
    7·2 answers
  • Match the word with the correct definition
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!