Question 1

Biology

2 answers:

Gnesinka [82]3 years ago

6 0

Answer:

Natural disasters such as this remove preexisting natural features that must be reestablished. What type of succession is this?

Secondary succession

Explanation:

Secondary succession entails when not all natural features are not totally wiped out during natural disaster leaving some behind that are now later re-established

Otrada [13]3 years ago

3 0

Answer:

Secondary succession occurs after the happening of natural disaster such as flood, volcanic eruptions and hurricane etc.

Explanation: Succession refers to the colonization of a particular species after the destruction occurs in the area.

Secondary succession is a kind of ecological succession which occurs after primary succession. This succession occurs after the removal of primary succession by the occurance of natural events such as fire, hurricane and flood etc.

You might be interested in

James was observing cells under a microscope. He observed some cells which had a layer outside the plasma membrane. What is this

irga5000 [103]

It's a cell wall, common to some types of cells, like plant cells (one notable component of the cell wall is <span>cellulose, which is exactly where we obtain it from</span>).

4 0

4 years ago

Read 2 more answers

Neutrons are also known as what

AleksandrR [38]

a subatomic particle of about the same mass as a proton but without an electric charge, present in all atomic nuclei except those of ordinary hydrogen.

3 0

3 years ago

Most living things need oxygen to survive. You breathe in oxygen and it is carried to this organ. Here the red blood cells pick

Ainat [17]

C) the lungs.
The air moves down the trachea and into the lungs where it is picked up by the blood

3 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What is your opinion on climate change? Do you believe it is the naturally occurring fluctuations of Earth's temperature? OR Do

Alinara [238K]

I do believe that it is both naturally occurring and caused by human activity. Although science has proven that it is something that naturally progresses with time, humans have sped up the process. Hope this helps:)

3 0

3 years ago