1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
10

Steroid hormones produce their effects in cells by _____.

Biology
2 answers:
Gwar [14]3 years ago
8 0

Answer:

The correct answer will be- binding intracellular receptors and then regulation of specific genes

Explanation:

The hormones produced by the cells act on the cell by a variety of mechanism in which the steroid hormones act on the target cell by binding to the intracellular receptors composed of proteins which allow easy diffusion of the steroid hormones into the cell.

These intracellular receptors act as a transcription factor which acts as either repressors or activators. Thus, this allows the steroid hormones to act as a regulator of the gene expression of the specific genes.

Thus, binding intracellular receptors and then regulation of specific genes is the correct answer.

-BARSIC- [3]3 years ago
6 0
Binding to intracellular receptors and promoting transcription of specific genes.
You might be interested in
If a characteristic is X-linked it
solniwko [45]
A. occurs mostly in males. Females may exhibit symptoms but rarely. Female carriers are asymptomatic (not affected). Characteristic cannot be transmitted male to male. Affected males transmit the trait to all daughters.
6 0
3 years ago
Read 2 more answers
Body fat in humans includes both essential and storage body fat. Essential body fat is needed to maintain life and is generally
Valentin [98]

Answer:

Increase

Explanation:

Visceral fat is a type of storage body fat. It is stored in the abdominal cavity and often surrounds many vital internal organs like stomach and liver. Over the time it forms a layer around these organs and also deposits in arteries which can cause many problems.

It can lead to insulin resistance which increases the risk for type 2 diabetes. It can also lead to other chronic conditions like heart disease and stroke. Hence, its increased amount is not good for the body. It can be decreased by proper diet, exercise and decreasing stress.

6 0
3 years ago
3. What is true of a gas?
antiseptic1488 [7]

A or C

Explanation:

Gas does not have a volume correct me if im wrong

5 0
3 years ago
Critics of sustainable agriculture claim that its farming methods will result in _________________. A) water pollution B) lower
Vinil7 [7]

Critics of sustainable agricilture claim that its farming methods will result in <u>lower crop yields</u>.

B) lower crop yields is your answer

I hope this helps you!!!!

4 0
3 years ago
What are the constituent elements of the blood?
Andrews [41]
<span>Blood is a liquid and has cellular parts. The liquid contains substances such as proteins and lipids. The cellular constituents are erythrocytes (red blood cells), leukocytes and platelets.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Paramecium feeds by pinocytosis.<br> T or F?
    15·1 answer
  • When fatty acids cannot pack together tight enough to make a solid fat, they have ...
    7·1 answer
  • In one to three sentences, describe what happens during the regeneration stage of the Calvin cycle.
    9·2 answers
  • What is the definition of the word common in environmental science?
    10·2 answers
  • Which statement best describes how enzymes function in the body?
    5·2 answers
  • What is the relationship between exergonic reactions, endergonic reactions and the use and regeneration of ATP?
    15·1 answer
  • Society has changed its view of smoking since the 1960's. The major cause of this change was
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What is a SNP mutation?
    5·1 answer
  • Vision depends on an image to be projected onto the?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!