Answer:
Between mars and Jupiter
Explanation:
between mars and jupiter is where the astriod belt is located. (between the rock and gas planets)
Answer:
To lose its function
Explanation:
Denaturation of macromolecules such as proteinc or nucleic acid, means that they lose their quaternary structure, tertiary structure, and secondary structure under the influence of a certain factor. The factors that can lead to denaturation are external stress, strong acid or base, a concentrated inorganic salt, radiation or heat. The consequence of denaturation is loss of biological activity for example, loss of the catalytic ability of an enzyme.
The answer is RNA polymerase binds to a promoter region of DNA.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:Un estudio de la Universidad de Barelona demuestra, por primera vez, cómo pueden separarse los genes a lo largo de los linajes evolutivos mediante el mecanismo de la retrotransposición, que es la síntesis de ADN a partir de ARN a través de la transcriptasa inversa.
Explanation:
