One mL equal one gram.
To convert from mL to grams, just multiply the mL by 1 and vice versa.
Your answer is D have a nice day.
Answer:
1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA
2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA
3. ??
4. It will affect the protein so the leg wont have enough protein or have too much.
Explanation:
Answer:
A pathway, which is used within the body to develop glucose from the non-carbohydrate sources is termed as gluconeogenesis. This process permits the body to accumulate the required energy in the form of glucose within the brain. The mentioned phenomenon takes place in the kidneys and liver.
The stimulation of the process takes place by the diabetogenic hormones like cortisol and glucagon and the substrates, which are required for the process include lactate, glycerol, and some kind of amino acids. In the process of gluconeogenesis, the reverse of the glycolytic and fermentation pathways takes place, that is, by transforming the substrate lactate initially into pyruvate and eventually back into glucose.
Of the mentioned molecules, glucose-6-phosphate, acetyl-CoA, and glucagon work as an activator of gluconeogenesis and insulin and AMP function as an inhibitor of the process. However, ATP and fructose-1,6-bisphosphate neither works as an activator or inhibitor of the process.
Study of the analogy i.e., the convergent evolution of the birds would help in that case. If we study the analogy of the birds, we would be able to know about the environment that they live in. For example, if the birds have the granivorous features, then it is confirmed that lived in or near a forested environment. The birds or animals, in general, adapt themselves to live in a particular condition or climate, without which they would die. Therefore, typical features of the birds provide information about their habitat.
When modern and fossil birds have similar features, that means that both birds lived in a similar type of climatic conditions and thus, did not had to change or adapt themselves differently.