1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
3 years ago
11

A hormone imbalance may cause a man to develop certain female secondary sex characteristics. Gynecomastia is a condition in men

where their breasts swell and become abnormally large. A low level of which hormone would cause this condition?
follicle-stimulating hormone
progesterone
estrogen
testosterone
Biology
2 answers:
nordsb [41]3 years ago
5 0
A low level of testosterone, and an increased level in estrogen.
BigorU [14]3 years ago
4 0

The correct answer is:

A low level of testosterone, and an increased level in estrogen.

Explanation:

True gynecomastia is an expansion of the male breast gland because of a hormonal imbalance, but the appearance of the enlarged breast may be ascribed to pseudogynecomastia, a symptom of excess fat which deposits on the chest. It can be common and acting in boys going through adolescence.

You might be interested in
Every interaction with the outside world is because of A) epithelial tissue B) connective tissue C) nervous tissue D) muscular t
algol13

Answer:

A cutaneous membrane is a multi-layered membrane composed of epithelial and connective tissues. The apical surface of this membrane exposed to the external environment and is covered with dead, keratinized cells that help protect the body from desiccation and pathogens....

4 0
3 years ago
What is the difference between inorganic and organic compounds? A. Organic compounds are produced naturally and inorganic compou
anygoal [31]

D. Organic compounds contain carbon and inorganic compounds do not.

4 0
3 years ago
What kind of organisms are rotifers?
Ierofanga [76]

Answer:

microscopic and near-microscopic pseudocoelomate animals.

Explanation:

3 0
4 years ago
Read 2 more answers
What are some comparisons with the compound light microscope and a transmission electron microscope
uysha [10]
Compound light microscope and a transmission electron microscope share some similarities, these include:
1. Both of them are used for observing microscopic substances which can not be observed with naked eyes.
2. Specimens preparation prior to use is necessary when using both microscope. 
3. Both are used in research work and analysis
4. Both can be used for microphotography.

5 0
4 years ago
How do you determine amino acid sequencing
damaskus [11]

Answer:

there are two main methods used to find the amino acid sequences of proteins. Mass spectrometry is the most common method in use today because of its ease of use. Edman degradation using a protein sequenator is the second method, which is most useful if the N-terminus of a protein needs to be characterized.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following makes ice cores so useful in determining the composition of the atmosphere in the past? A. the presence o
    15·1 answer
  • Where is the important information being stored in dna?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Is it more expensive to use ethanol or too use oil at todays prices
    14·1 answer
  • A plant is a____ because it can make its own food by performing photosynthesis.
    10·1 answer
  • Which of the following best defines velocity?
    13·2 answers
  • Why does the pectoral girdle need to be flexible while the pelvic girdle needs to be rigid?
    13·1 answer
  • The use of living organisms to detoxify polluted ecosystems is called _____.
    5·1 answer
  • Please choose one of the multiple choice answers
    6·2 answers
  • Site of modification and packaging of proteins and lipids prior to export from the cell.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!