1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
5

Which statement about the polarity of DNA strands is true?A) The 3' end has a free OH groupB) The 5' end has a free OH groupC) T

he 3' end has a free phosphate group
Biology
1 answer:
aleksley [76]3 years ago
8 0
I believe the correct answer would be C.) The 3’ end has a free phosphate group
You might be interested in
An example of active transport
Viktor [21]
Examples of active transport include the uptake of glucose in the intestines in humans and the uptake of mineral ions into root hair cells of plants.
3 0
2 years ago
Construct a food chain for each list of organisms below
lina2011 [118]


Let me try...

How about, grass, moose(moose eats grass), black fly(when moose dies it's eaten by fly), fish(fish can catch flies sometimes), and then Osprey(birds eat fish).

The second one... How about, grass, deer(deer eats grass), then wolf(eats deer), the mosquito(sucks wolf's blood), I don't know the dragon fly though

HOPE THAT HELPED SOMEWHAT :)

3 0
3 years ago
9. A protein molecule which is denatured, has
seraphim [82]

Answer: B. combined with another molecule

Explanation:

i just took the test

4 0
2 years ago
Give the sequence of DNA that would match the following DNA strand
creativ13 [48]

Answer:

GATCCGGTAT

Explanation:

A = T, G = C

3 0
2 years ago
When was Barack Obama born
Lemur [1.5K]
August 4th, 1961.........................................
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following would most likely be key to gathering evidence that the RNA World hypothesis is valid?
    10·1 answer
  • What do all bacteria have in common?
    8·2 answers
  • The surface area/volume ratio is an important factor for one celled organisms. All the parts of a cell go into making its volume
    8·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • 11. A fossil for an extinct organism is found in layer 2. A fossil for another extinct organism,
    14·1 answer
  • I need help i’ll mark brainlyist.
    7·1 answer
  • Can you please help me
    12·1 answer
  • Which statements describe how traits are inherited.
    7·2 answers
  • The digestive and respiratory rely on the ___ system to<br> transport needed materials to the cells.
    9·2 answers
  • Haven't Answered a Question lately So I'll ask
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!