1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mama L [17]
4 years ago
7

What is the primary source of fuel for the brain?

Biology
1 answer:
olga2289 [7]4 years ago
6 0

Answer:

it's answer C

That is Carbohydrates

Explanation:

"The brain's primary source of fuel is carbohydrates,". "Those carbohydrates are broken down into sugar in a form called glucose. Your brain uses glucose as its main source of energy."

You might be interested in
Why do scientists believe that warm climates provide greater biodiversity.
igomit [66]
Because organisms and such can only thrive meaning produce in warm areas.<span />
8 0
4 years ago
Read 2 more answers
Growing sugar beets for sugar, as an alternative to importing sugar made from sugar cane, is an example of
taurus [48]
Sugar beets for sugar tend to have more minerals and are typically more easy to find than sugar cane so maybe an example of Conservation.
5 0
3 years ago
Read 2 more answers
Eukaryotic cells of humans and animals possess a selective advantage in the fact that
schepotkina [342]
D. I,III and V

This is correct because all of the following occur during anaerobic respiration. (I took AP Bio :) )
7 0
4 years ago
A prenatal client with vaginal bleeding is admitted to the labor unit. which signs or symptoms indicate placenta previa? select
adelina 88 [10]
The symptom and sign which indicate placenta previa here is Pinless vaginal bleeding.
Placenta previa is a condition where the placenta is covering the cervix or it is attached close to the cervix.
In various times of pregnancy, bleeding may occur. It can not be a serious complication. The cause of the bleeding may depend on the amount of pain or the time of bleeding in pregnancy.
In the first trimester, bleeding may occur and may be due to ectopic pregnancy, miscarriage, implantation of the placenta in the uterus or infection.
Bleeding in late pregnancy lets say twenty weeks can be due to placenta previa or placental abruption.
3 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Other questions:
  • About what percentage of calories in the typical american diet are derived from simple sugars and fats adding both together
    7·1 answer
  • How does diabetes affect the respiratory system?
    5·1 answer
  • What is the mass , in kilograms , of a 100 lb person on earth? What is the mass of the person above on the moon?
    9·1 answer
  • B. What element does decomposition release from deceased organisms?
    5·1 answer
  • For what cell process is the mitochondria (picture below) responsible?
    6·1 answer
  • Which convection cell in the atmosphere lies to the north of the polar jet stream
    12·1 answer
  • Select the correct statement regarding epithelia.A) Simple epithelia form impermeable barriers.B) Stratified epithelia are prese
    12·1 answer
  • Which characteristic is true about all planets in our solar system?
    10·1 answer
  • What is the 2 difference between botany and zoology
    9·1 answer
  • What measurements can be used to determine how colors of light affect plant growth
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!