1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
6

How did mount st. helens form

Biology
2 answers:
Free_Kalibri [48]3 years ago
6 0
Volcanoes form the Mountain, from the lava.
yuradex [85]3 years ago
5 0
It was a Volcano that became dormant and turned into a "Mountain"
You might be interested in
If we flipped a coin 100 times. How many times would we have to get heads to be significantly
MrMuchimi

Answer:

24

Explanation:

thats my guess

3 0
3 years ago
Read 2 more answers
How did Franklin's X-ray photograph affect the work of watson<br> and crick?
maw [93]

Answer:

Franklin took Photo 51 after scientists confirmed that DNA contained genes. Maurice Wilkins, Franklin´s colleague showed James Watson and Francis Crick Photo 51 without Franklin´s knowledge. Watson and Crick used that image to develop their structural model of DNA.

Explanation:I took that but if ya read it you will know what it is trust me.

7 0
3 years ago
Why do you think that joule's father built him a science lab when he was young ?
ollegr [7]
<span>Joule suffered from a chronic spinal injury. He's father built him the science lab because it made him happy and since he was so sick he's father wanted him to be happy. Hes father was wealthy so he had plenty of money to spend on he's son.</span>
6 0
3 years ago
Where do most living things get the energy they need for lite?
Vesnalui [34]

Answer:

food and sunlight

Explanation:

C

8 0
3 years ago
Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGC
Verizon [17]

Answer:

Explanation:

In the DNA, the nitrogen bases, Adenine A (a purine) forms double bond with Thymine T (a pyrimidine) but in RNA, the bond is with Uracil U (a pyrimidine) instead of Thymine; Guanine G (a purine) forms triple bond with Cytosine C (a pyrimidine): this also occur in RNA. This we have:

DNA sequence: 5' ATGCGTAGCCTAGCCTAGTAGCCTTC 3'

Complimentary strand : 3' TACGCATCGGATCGGATCATCGGAAG 5'

The RNA sequence is produced running from the 5' to the 3' direction thus, the complimentary strange will be used.

5'AUGCGUAGCCUAGCCUAGUAGCCUUC 3'

4 0
4 years ago
Other questions:
  • Andesitic rock is an igneous rock with a composition in between that of basaltic and granitic igneous rock. true or false.
    7·1 answer
  • If a person eats salty food, his or her kidneys respond by excreting excess salt into the ____.
    11·2 answers
  • What is a fossil?
    9·2 answers
  • trees that are installed individually or in small numbers to provide an eye- catching contrast to the more numerous background t
    15·1 answer
  • Which of the following is not the name of an air mass
    11·1 answer
  • Name the important trees of tropical monsoon forest​
    5·1 answer
  • HELPPPP ASAPP!!!!!!!!
    5·1 answer
  • Which of the following are similarities between animal cells and plant cells?
    11·1 answer
  • Boojho wonders why the level
    6·1 answer
  • What does it mean when organisms are in the same horizontal line<br>in a cladogram​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!