Metagenomics is the study of genetic material recovered directly from environmental sample. Its field has been responsible for substantial advances in microbial ecology, evolution, and diversity over the past 5 to 10 years and many research laboratories are actively engaged in it now. Using metagenomics, the distinctions between bacterial species are based upon the comparison of DNA nucleotide sequences of different bacterial species.
Bone scan is the technique which is used to detect cancer and osteomyelitis.
<span>Osteomyelitis is an inflammation of bone and bone marrow. In bone scan, a radioactive substance is injected into a vein. And then bone scan shows or indicate cancer in the body where too much or too small substance is absorbed.</span>
Both abiotic and biotic factors determine both where an organism can live and how much a population can grow. A limiting factor is a factor that restricts the size of a population from reaching its full potential
The amount of food & water in a habitat is an example of a limiting factor. Other factors include geographical space, predation, climate, competition (for prey, food, mates) etc. An example of a limiting factor is sunlight in the rainforest, where growth is limited to all plants in the understory unless more light becomes available. Or perhaps in a deciduous forest, there are not enough rabbits to support the growth of more foxes. All species within an ecosystem will experience some kind of limiting factors to prevent continuous and exponential growth. (Even humans) Environmental changes (i.e drought, famine, human destruction) results in decreased rates of physiological processes, lowering the potential for survival, growth, or reproduction. Species will undergo Acclimatization to adjust to the new limiting factors through changing their behavior or physiology.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
I believe the correct answer among the choices presented above is the last option. It is in the Sahara desert that most-likely there is physical water scarcity. This is because it is a desert and it is a characteristic of a desert to have very small or no amount of water. Also, the climate their is very hot.
