1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
8

How do organisms store and use energy?

Biology
2 answers:
balu736 [363]3 years ago
5 0
<span>❅ By making and as well as  breaking up the chemical bonds in organic compounds.

</span>
Aneli [31]3 years ago
5 0
By making and breaking the chemical bonds in organic compounds.<span>of course , we can give , chemosynthesis and photosynthesis as examples for storing (making bonds) energy , aerobic and anaerobic respirations are examples for using(breaking bonds) energy.</span>
You might be interested in
Utilization of the CODIS and NADNA has helped solve _____. all crimes many cold cases many social problems many medical and dise
Degger [83]
Answer is all crimes that includes several cold cases. These range from conviction of crimes from cold cases, finding missing persons and matching dna samples from crimes scenes. CODIS databases vary depending on the information they hold in their database. They include the LDIS, NDIS, SDIS, depending on the problem they were developed to solve.
4 0
3 years ago
Read 2 more answers
I DONT UNDERSTAND PLS HELP
Eddi Din [679]

Answer:

Memory cells are specalised types Nerve Cells .

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What are roles of producers, consumers, and decomposers in an ecosystem​
Daniel [21]
An organism that obtains energy and nutrients by feeding on other organisms or their remains. A food web is a model of the feeding relationships between many different consumers and producers in an ecosystem. Without plants (the primary producers) consumers and decomposers would not be able to live. Producers always start every food chain. A consumer, also called a heterotroph, is an organism that cannot make its own food. It must eat producers or other organisms for energy.
5 0
3 years ago
What distinguishes an amniotic egg from eggs laid by other animals, including fishes, amphibians, and invertebrates?
PIT_PIT [208]

The difference between an amniotic egg and eggs laid by other animals is : Absence of Membrane ( amnion ) and absence of larval stage

<h3>Characteristics of an amniotic egg</h3>

Eggs laid by amniotes are different from other eggs laid by fishes, amphibians and invertebrates in that they lack a membrane and a larval stage. the shell of the amniotic egg protects the embryo in the absence of a membrane. The shell also allows for the exchange of oxygen and carbon dioxide between the the embryo and the environment.

Hence we can conclude that The difference between an amniotic egg and eggs laid by other animals is : Absence of Membrane ( amnion ) and absence of larval stage

Learn more about amniotes : brainly.com/question/19158601

#SPJ1

7 0
2 years ago
Other questions:
  • Which of these individuals is likely to be most successful in an evolutionary sense?
    6·1 answer
  • A ventricle is one of the two muscular v shaped chambers that pump blood out of the heart
    7·1 answer
  • Which is an example of competition within a species?
    8·1 answer
  • A family has a Y-linked disease that affects the father. What is the chance of a male offspring inheriting the same disease?
    12·2 answers
  • Tuberculosis and Acquired Immunodeficiency Syndrome (AIDS) are caused by two different infectious agents. Tuberculosis is caused
    13·1 answer
  • At what stage of development does the brain essentially reach its adult size?
    14·1 answer
  • What is the purpose of a conclusion?
    8·1 answer
  • how might a carrying capacity of a coastal ecosystem change as the result of a tsunami? Explain using one or more examples
    12·1 answer
  • A<br>TI<br>12 h<br>A<br>С C<br>we<br>4<br>gi<br>de<br>A.<br>С.<br>D​
    14·1 answer
  • Which procedure is involved in the development of the fetus?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!